ID: 989202065

View in Genome Browser
Species Human (GRCh38)
Location 5:38773549-38773571
Sequence CAGAAGGAACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989202056_989202065 23 Left 989202056 5:38773503-38773525 CCAGGTAAATTATGGATAGATAG No data
Right 989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989202065 Original CRISPR CAGAAGGAACAGATGGAGGA AGG Intergenic
No off target data available for this crispr