ID: 989203890

View in Genome Browser
Species Human (GRCh38)
Location 5:38792652-38792674
Sequence TGCTGTAGACATAGTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989203885_989203890 18 Left 989203885 5:38792611-38792633 CCTCACAGGTTTAATTGACTTGA No data
Right 989203890 5:38792652-38792674 TGCTGTAGACATAGTGGGCCTGG No data
989203887_989203890 -5 Left 989203887 5:38792634-38792656 CCATGAATCAATAAGGAATGCTG No data
Right 989203890 5:38792652-38792674 TGCTGTAGACATAGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989203890 Original CRISPR TGCTGTAGACATAGTGGGCC TGG Intergenic
No off target data available for this crispr