ID: 989205503

View in Genome Browser
Species Human (GRCh38)
Location 5:38805434-38805456
Sequence CTCCCAGCTCAGGGAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989205496_989205503 -3 Left 989205496 5:38805414-38805436 CCTGCTTACCTAAGCACATCCTC No data
Right 989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989205503 Original CRISPR CTCCCAGCTCAGGGAGGGTC TGG Intergenic
No off target data available for this crispr