ID: 989212929

View in Genome Browser
Species Human (GRCh38)
Location 5:38874729-38874751
Sequence GTACAGGGGGACACAGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989212920_989212929 8 Left 989212920 5:38874698-38874720 CCAATGCTCCTGTCTTAACAGTT 0: 1
1: 0
2: 0
3: 11
4: 147
Right 989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 198
989212919_989212929 28 Left 989212919 5:38874678-38874700 CCGTGCAAACTTTGACTGGGCCA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 198
989212923_989212929 0 Left 989212923 5:38874706-38874728 CCTGTCTTAACAGTTGGAGGACA 0: 1
1: 0
2: 1
3: 7
4: 117
Right 989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989212929 Original CRISPR GTACAGGGGGACACAGGTGT TGG Intronic
900376866 1:2358952-2358974 GTACAGGGGTACAGGGGTATTGG - Intronic
902176260 1:14653239-14653261 GAACAAAGGGTCACAGGTGTAGG + Intronic
902395927 1:16132531-16132553 GGAGAGGTGGGCACAGGTGTGGG + Intronic
902847732 1:19125367-19125389 GTAGAGGGGAAGACAGGTGAAGG + Intronic
903012508 1:20341391-20341413 GTAAATGGGTACACAGCTGTGGG - Intronic
903360300 1:22772771-22772793 GTACAGTGGGATAAAGGTATGGG + Intronic
904494455 1:30878750-30878772 GTAGAGGTGGACACAGGGCTCGG + Intronic
905897313 1:41557355-41557377 GTTCAGAGGGACACAGAGGTGGG + Intronic
907471632 1:54677809-54677831 GGATATGGGGACACAGGAGTGGG + Intronic
907810152 1:57861094-57861116 GAATATAGGGACACAGGTGTTGG + Intronic
911959532 1:104283062-104283084 ATATAGGGGGAAAAAGGTGTGGG - Intergenic
915206106 1:154271599-154271621 GTACAGGGAGAGACAGGTCTCGG + Intergenic
915515143 1:156408302-156408324 GTGCAGAGGGACACAGTTATGGG - Intronic
915918225 1:159954033-159954055 GGGCAGGGGAACAGAGGTGTAGG + Intronic
920509342 1:206539351-206539373 ATACTGGGGGACCCAGGTGCTGG + Intronic
923346078 1:233053904-233053926 GTTCTGTGGGTCACAGGTGTTGG - Intronic
1063985819 10:11500307-11500329 GTTCAGGGGTACACATGTGCAGG - Intronic
1067529226 10:47058486-47058508 GTGCAGAGGGACACACGTGTGGG + Intergenic
1071717672 10:88113597-88113619 CTACTGAGGGACACAGGTCTGGG + Intergenic
1074761630 10:116670795-116670817 GTGGAGGGCGACTCAGGTGTAGG + Intergenic
1074886407 10:117697098-117697120 GTACAGGTGTGCACATGTGTGGG + Intergenic
1075508132 10:123044253-123044275 GTAGAGGGAGACACAGATGCCGG + Intronic
1075656414 10:124164554-124164576 GTAGAGAGGGACAGTGGTGTGGG - Intergenic
1077371110 11:2182038-2182060 GCCCTGGGGGCCACAGGTGTAGG + Intergenic
1079094896 11:17503878-17503900 GTGCAGTGAGACATAGGTGTTGG - Intronic
1083147705 11:60771356-60771378 GAACAGGGGGACCCAGGGGCGGG + Intronic
1088888580 11:114027062-114027084 CTACAAAGGGACACAGGTGCTGG + Intergenic
1089583053 11:119493480-119493502 GTAGAGTGGGACACAGGTGAGGG - Intergenic
1090998750 11:131890434-131890456 GTGCAGGGGGAGACAGTGGTAGG + Intronic
1091804101 12:3343609-3343631 GCACAGGGTACCACAGGTGTTGG + Intergenic
1092288450 12:7143597-7143619 GTAAAGTGGGACACAGGATTGGG + Intronic
1098269641 12:68757501-68757523 GCACAGGGGGACAAATGGGTTGG - Intronic
1099810090 12:87569445-87569467 CTTTAAGGGGACACAGGTGTTGG - Intergenic
1100659272 12:96679107-96679129 GAAGAGGGGGACCCAGGAGTGGG - Intronic
1101515590 12:105432133-105432155 CTACAGGGAGACCCAGTTGTTGG + Intergenic
1102377005 12:112430556-112430578 GTAGATGGGACCACAGGTGTGGG + Intronic
1102914755 12:116744559-116744581 GTGCTGGGGGACACAGGGATGGG - Intronic
1109280938 13:60354534-60354556 GTACAGGTGAACAGAGGGGTAGG + Intergenic
1109793262 13:67277443-67277465 GTCAAGGGGGAGACAGGTGGAGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112286755 13:98111545-98111567 CTGCAGGTGGACACAAGTGTAGG + Intergenic
1113813626 13:113157261-113157283 GTCCAGGTGGAGACAGGAGTGGG - Intergenic
1116780368 14:49230406-49230428 ATACAGAGGGGCACATGTGTAGG + Intergenic
1119654537 14:76407755-76407777 GGAAAGGGGGACAGAGGTGCTGG + Intronic
1119709154 14:76809004-76809026 GAACAGGGTGTCTCAGGTGTGGG - Intronic
1121045403 14:90784220-90784242 ACACAGGTGGACACAGGGGTAGG - Intronic
1123025504 14:105421845-105421867 GCACAGGGGGACAGAGGGTTCGG - Intronic
1129825935 15:78635007-78635029 GTACAGAGAGGCCCAGGTGTAGG - Intronic
1131579229 15:93625660-93625682 GTAGAAGGGGACACAGGATTGGG + Intergenic
1132497118 16:269146-269168 GCACAAGGGGACACTGGTGCTGG + Exonic
1136383395 16:29907656-29907678 GTAGCTGGGAACACAGGTGTGGG - Intronic
1136778601 16:32884233-32884255 GGACAGAGGGATACAGGTGCGGG + Intergenic
1136892019 16:33977281-33977303 GGACAGAGGGATACAGGTGCGGG - Intergenic
1137043968 16:35639343-35639365 GTCCAGGGGGTCTCAGTTGTGGG - Intergenic
1137559773 16:49495124-49495146 TGCCAGGGAGACACAGGTGTGGG + Intronic
1139756857 16:69150944-69150966 GGACAGGGGGACACAGGGATGGG - Intronic
1141141345 16:81498600-81498622 GTTCTGGGGCACACATGTGTGGG - Intronic
1142068178 16:88074598-88074620 GGACAGTGGGGCACAGGTCTGGG - Intronic
1142188952 16:88708498-88708520 ATACAAGGAGACACAGGTGCTGG - Intronic
1203081017 16_KI270728v1_random:1146327-1146349 GGACAGAGGGATACAGGTGCGGG + Intergenic
1143163672 17:4886947-4886969 GGACAGCGGGTCTCAGGTGTGGG - Intronic
1144288914 17:13806743-13806765 CTACAGGGAGACACAAGTGCAGG + Intergenic
1144659754 17:17060372-17060394 GTAAAGGGTGACACAGGTGAAGG - Intronic
1144664506 17:17092770-17092792 CTGCAGGGAAACACAGGTGTAGG + Intronic
1144767851 17:17742675-17742697 GCTCTGGGGGACTCAGGTGTGGG - Intronic
1147661508 17:42119449-42119471 GTCGAGGGGGAGACAGGTGAGGG + Intronic
1148106110 17:45119883-45119905 GCACAGGGGCACACAGGAGTGGG - Intronic
1148834665 17:50459746-50459768 GCACAGGTGGAAACAGGTCTGGG - Intronic
1149436563 17:56638598-56638620 GGACAAGAGGACACAGGTGCAGG + Intergenic
1151786850 17:76279286-76279308 GGACAGGTGGACACAGGTGAAGG + Intronic
1151849607 17:76682659-76682681 ATGCAGGGGGGCAGAGGTGTGGG + Intronic
1152247490 17:79192724-79192746 GCCCAGGGAGACAGAGGTGTAGG - Intronic
1152783283 17:82235842-82235864 GGTCAGGGGGCCACAAGTGTGGG + Exonic
1152901109 17:82941658-82941680 CCACAGGGGCCCACAGGTGTGGG - Intronic
1155232467 18:23786564-23786586 CTACAAGTGGACACAGGTGGAGG - Intronic
1157871301 18:51232347-51232369 GTACAGAGGCAAACAGGTGGGGG + Intergenic
1161592109 19:5133569-5133591 GTCCAGGGAGAACCAGGTGTTGG + Intronic
1164156607 19:22601262-22601284 GTTGCGGGGGACCCAGGTGTGGG + Intergenic
1164570703 19:29372379-29372401 CTACAGGGGGATGCAGGTGTTGG - Intergenic
1165806528 19:38584284-38584306 GTGGGGGGGGGCACAGGTGTAGG - Intronic
1167675032 19:50878549-50878571 GGACAGGGGCACTCAGGGGTTGG - Exonic
926047091 2:9717774-9717796 GGAGAGGGGGACTCAGGGGTTGG + Intergenic
926190387 2:10723210-10723232 GAACAGGGGGACAAGGTTGTGGG + Intronic
926226769 2:10972452-10972474 GTCCAGGGGGACACTGATGAAGG + Intergenic
926856512 2:17262265-17262287 GTTCAGGTGGACACAGATGTGGG - Intergenic
927448358 2:23185475-23185497 GAACAGGGGGAGACAGGTAGAGG - Intergenic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
940977444 2:159961757-159961779 GTACAGGAGGACACATGGGATGG + Intronic
942758998 2:179376102-179376124 GTACATGAGGATACAGTTGTAGG - Intergenic
942931301 2:181496542-181496564 ATACAGAGGGACATAGGTGACGG - Intronic
944001795 2:194848546-194848568 GTAGCTGGGGTCACAGGTGTGGG + Intergenic
946322391 2:218961443-218961465 GCAGATGGGGACACAGGTGCAGG - Exonic
1169644228 20:7791245-7791267 GTTCAGGGGGACACATGTGCAGG + Intergenic
1172573282 20:35986944-35986966 GGCCAGGGGGACACAAGGGTTGG + Intronic
1172762196 20:37330741-37330763 TTAAAGGAGGAGACAGGTGTTGG - Intergenic
1173899288 20:46575520-46575542 GAACAGTGGGAGGCAGGTGTGGG - Intronic
1176092530 20:63325508-63325530 GGCCAGGGGGCCACAGGGGTTGG + Intronic
1176191904 20:63815421-63815443 GTGCAGGTGGGCACAGGTGCAGG + Intronic
1176243586 20:64086186-64086208 GGCCAGGGGGACACATGGGTGGG + Intronic
1178725087 21:35044276-35044298 GGAGAGAGGGACACAGGAGTTGG - Intronic
1179770557 21:43612298-43612320 GGCCAGGATGACACAGGTGTTGG + Intronic
1183173312 22:36203980-36204002 GAACAGAGGGACAGAGGTGAGGG + Intronic
1183178054 22:36238791-36238813 GAACAGAGGGACAGAGGTGAGGG + Intronic
1183180046 22:36253813-36253835 GAACAGAGGGACAGAGGTGAGGG - Intronic
1183819029 22:40329622-40329644 GTAAAGGGGGACACAGGTCAGGG + Exonic
1184074850 22:42169733-42169755 GCACAGGTGGGGACAGGTGTGGG + Intronic
1185088048 22:48751251-48751273 GAACGCGGGGACACAGGCGTGGG - Intronic
1185237559 22:49723758-49723780 GTACTGGGGAGCACAGGTGTGGG - Intergenic
950167729 3:10814479-10814501 GCACATGGGGACAGAGGTTTGGG + Intergenic
950676070 3:14555212-14555234 GGACAGGGGGACATAGGTGAAGG - Intergenic
953489873 3:43340518-43340540 GTACAGAGGGCCACAGGTTTAGG + Intronic
953707277 3:45240814-45240836 TGACAGGTGGACACAGGTGTTGG + Intergenic
955048435 3:55384367-55384389 GTACAGACGGACAGAGGAGTGGG + Intergenic
955531405 3:59876615-59876637 CTACAGGGTAACACAGGTGAAGG + Intronic
955618528 3:60835655-60835677 GTGCAGTGGCACACAGGTATTGG + Intronic
962251623 3:133839479-133839501 GTGCAAGGGCACACAGGTGCAGG - Intronic
966124651 3:176561977-176561999 GTTCAGGGGAGCACAGGTGCTGG - Intergenic
966324129 3:178735267-178735289 GGACAGAGGGACACAGGAGATGG + Intronic
968533959 4:1112675-1112697 GATGAGGGGGACACAGGGGTCGG - Intronic
968552132 4:1229188-1229210 GTGCAGAGGCACACAGGTGGAGG + Intronic
968633642 4:1666401-1666423 ATACAGGGGGGTACAGGTGCAGG - Intronic
968833015 4:2942923-2942945 GTACAGTGGGGCAGAGGTGCCGG + Intronic
968916188 4:3497962-3497984 GTGCCCTGGGACACAGGTGTGGG + Intronic
969062093 4:4444493-4444515 ATACATGGTGACACAGGTATTGG + Intronic
969229842 4:5822274-5822296 GTCTTGCGGGACACAGGTGTTGG + Intronic
969388413 4:6872412-6872434 GTAGAGAGGGAGACAGGAGTGGG + Intronic
972065830 4:34942406-34942428 GTACAGGACGACACAGTTTTTGG + Intergenic
973696797 4:53498084-53498106 ATACCAGGGGAGACAGGTGTTGG - Intronic
983164003 4:164452179-164452201 GTAGAAGGGGTCACAGGTGGTGG - Intergenic
984091205 4:175377345-175377367 GTACGTGGGGACACTGTTGTGGG + Intergenic
984828919 4:183953365-183953387 GTAAAGGGGCAACCAGGTGTGGG - Intronic
984929460 4:184833976-184833998 GTACAGGGTGGCACAGCTCTGGG - Intergenic
985018011 4:185657526-185657548 GTACAGGGGGATAGAGCTGCTGG + Exonic
986907492 5:12512873-12512895 GTCAAGGGGGAACCAGGTGTAGG - Intergenic
988839095 5:35065770-35065792 GCACTGGGGGTCCCAGGTGTGGG + Exonic
989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG + Intronic
991577770 5:68122653-68122675 GCACTGGCGGACACAGGTCTGGG - Intergenic
992088476 5:73298410-73298432 GAACAGGGGGACACGGGAGAGGG - Intergenic
994406442 5:99351863-99351885 GTACACAGGTACACAGTTGTTGG - Intergenic
996365938 5:122701593-122701615 GTCCAGGGAGAAACAGGTGGAGG - Intergenic
997353977 5:133250552-133250574 GTTCAGGGGGATACATCTGTTGG - Intronic
997406757 5:133655105-133655127 GCACAGGAGGAAATAGGTGTAGG - Intergenic
1002566560 5:180115490-180115512 GTAGTGGGAGACACAGTTGTAGG + Intronic
1004433832 6:15570605-15570627 GTACAGGGAGACACAGCCTTTGG - Intronic
1007301162 6:40868923-40868945 GTACAGAGGGGCCCAGGTCTGGG - Intergenic
1007320264 6:41023366-41023388 GTACAGGGAGGCACAGGGGCTGG + Intergenic
1007608435 6:43132720-43132742 GTGGAGGGGAACACAGGTCTGGG + Intronic
1008507842 6:52247846-52247868 GTCCAGTTGGACACAGATGTGGG - Intergenic
1011492436 6:87906424-87906446 GTAGAGGAGGAAACAGGAGTGGG + Intergenic
1014781295 6:125567776-125567798 GAACCGGGGGACACAGGACTGGG - Intergenic
1015820097 6:137251838-137251860 TTACAGGGGGATATATGTGTAGG - Intergenic
1016834298 6:148461976-148461998 GTACAGGGGGAGGCAGGGGAAGG - Intronic
1019670320 7:2274505-2274527 GCCCAGGGGGACACAGGCCTGGG + Intronic
1019904893 7:4054469-4054491 GTACAGTTTGACACATGTGTAGG + Intronic
1022339408 7:29454219-29454241 GTACAGGGGAGCAGAGATGTGGG + Intronic
1022496602 7:30856842-30856864 GCACAGGGGGACACAGGCTCAGG - Intronic
1027468672 7:78546596-78546618 ACACAGGGGGACACAGCTGTTGG - Intronic
1030112514 7:106038788-106038810 GTCCAGGGGGGCAGAGGTGGAGG + Intergenic
1032794533 7:135267174-135267196 TTACAGGGGCACCAAGGTGTGGG - Intergenic
1033542779 7:142372563-142372585 GAAGTGGGGGACACAGGGGTGGG - Intergenic
1034277271 7:149829405-149829427 GTGGAGGGGGACACAGGAGGAGG - Intergenic
1035281042 7:157778529-157778551 GTACATGTGAATACAGGTGTTGG + Intronic
1035701432 8:1641916-1641938 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701469 8:1642040-1642062 GTCGAGGGTGACACAGGTGGGGG - Intronic
1035701490 8:1642102-1642124 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701528 8:1642226-1642248 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701548 8:1642288-1642310 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701558 8:1642319-1642341 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701577 8:1642381-1642403 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701616 8:1642505-1642527 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701626 8:1642536-1642558 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701656 8:1642629-1642651 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701702 8:1642785-1642807 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701788 8:1643064-1643086 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701808 8:1643126-1643148 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701818 8:1643157-1643179 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701829 8:1643188-1643210 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701839 8:1643219-1643241 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701847 8:1643250-1643272 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701867 8:1643312-1643334 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701877 8:1643343-1643365 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701886 8:1643374-1643396 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701897 8:1643405-1643427 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701907 8:1643436-1643458 TTCCAGGGTGACACAGGTGAGGG - Intronic
1035701960 8:1643622-1643644 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035701988 8:1643715-1643737 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035702017 8:1643808-1643830 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035702027 8:1643839-1643861 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035702056 8:1643932-1643954 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035702066 8:1643963-1643985 GTCGAGGGTGACACAGGTGAGGG - Intronic
1035994869 8:4534488-4534510 ATACAGCGGGGTACAGGTGTAGG + Intronic
1037928259 8:22862158-22862180 GTTCAGGAGGCCACAGGAGTCGG + Intronic
1039895310 8:41712971-41712993 GGACAGGAGGAGACAGCTGTCGG + Intronic
1040609839 8:48973123-48973145 GCATAGGGAGACACAGGTGCAGG - Intergenic
1044642336 8:94396474-94396496 TTACAGGAGGATATAGGTGTAGG - Intronic
1044929527 8:97238633-97238655 GCACAGGGGGAAACTAGTGTTGG - Intergenic
1046878154 8:119278543-119278565 GTATAGGGGGAAATAGGAGTTGG - Intergenic
1049605949 8:143529255-143529277 GGACAGAGGGACAGAGGGGTAGG + Intronic
1049622193 8:143603553-143603575 TCCCAGGGGGAGACAGGTGTTGG + Intergenic
1049642220 8:143720866-143720888 GTGCGGGGGGACAGAGGTGGGGG + Intronic
1052624874 9:30962241-30962263 GCACGGGGGGAAACAGGTGGTGG + Intergenic
1053398919 9:37800801-37800823 GAACAGGGGCACTGAGGTGTCGG + Exonic
1053461045 9:38271820-38271842 GCACAGAGGGATACAGGTGCTGG + Intergenic
1055731369 9:79282263-79282285 GTACATGGGGACGTAGGTGAGGG - Intergenic
1055989678 9:82092117-82092139 GTTCAGTGGGACACTGGTGAGGG + Intergenic
1057222459 9:93264548-93264570 GTGCTGGGGACCACAGGTGTGGG - Intronic
1061433360 9:130545090-130545112 GGACAGGGGGGCACAGGGGAGGG + Intergenic
1061519292 9:131108127-131108149 GTGCAGGAGGACACAGGTCCTGG + Intronic
1189946893 X:46188908-46188930 GTGCAGGGGCACATGGGTGTGGG - Intergenic
1190481223 X:50878783-50878805 GAACACGGGAACACAGGTTTTGG - Intergenic
1190866378 X:54388354-54388376 GCACAGGGGGACAAAAGTGGAGG - Intergenic
1192342162 X:70272984-70273006 GTACAGGGTGACAGAGGTTGAGG - Intronic
1197832653 X:130661316-130661338 GTAGCTGGGAACACAGGTGTGGG + Intronic
1200256561 X:154585760-154585782 AGATAGGGGGACCCAGGTGTAGG + Intronic
1200261208 X:154618643-154618665 AGATAGGGGGACCCAGGTGTAGG - Intronic