ID: 989213113

View in Genome Browser
Species Human (GRCh38)
Location 5:38877266-38877288
Sequence TTGGGTACACACATACAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989213107_989213113 4 Left 989213107 5:38877239-38877261 CCTGTCTTCACCCAGGTAGTGGA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data
989213104_989213113 11 Left 989213104 5:38877232-38877254 CCAGGCTCCTGTCTTCACCCAGG 0: 1
1: 0
2: 10
3: 40
4: 380
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data
989213103_989213113 26 Left 989213103 5:38877217-38877239 CCTCTGTCAGCTCAACCAGGCTC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data
989213102_989213113 27 Left 989213102 5:38877216-38877238 CCCTCTGTCAGCTCAACCAGGCT 0: 1
1: 0
2: 2
3: 17
4: 189
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data
989213112_989213113 -7 Left 989213112 5:38877250-38877272 CCAGGTAGTGGAGGCTTTGGGTA 0: 1
1: 0
2: 1
3: 11
4: 138
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data
989213111_989213113 -6 Left 989213111 5:38877249-38877271 CCCAGGTAGTGGAGGCTTTGGGT 0: 1
1: 0
2: 2
3: 13
4: 146
Right 989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989213113 Original CRISPR TTGGGTACACACATACAGCA TGG Intronic
No off target data available for this crispr