ID: 989213990

View in Genome Browser
Species Human (GRCh38)
Location 5:38884850-38884872
Sequence GAACCAGGCATCCAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989213990_989213993 7 Left 989213990 5:38884850-38884872 CCAGTCTCCTGGATGCCTGGTTC 0: 1
1: 0
2: 4
3: 26
4: 235
Right 989213993 5:38884880-38884902 TCCCCTTAGCATGACCACTAAGG No data
989213990_989214001 25 Left 989213990 5:38884850-38884872 CCAGTCTCCTGGATGCCTGGTTC 0: 1
1: 0
2: 4
3: 26
4: 235
Right 989214001 5:38884898-38884920 TAAGGGCAGCAGTAACGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 127
989213990_989213995 8 Left 989213990 5:38884850-38884872 CCAGTCTCCTGGATGCCTGGTTC 0: 1
1: 0
2: 4
3: 26
4: 235
Right 989213995 5:38884881-38884903 CCCCTTAGCATGACCACTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 65
989213990_989214000 24 Left 989213990 5:38884850-38884872 CCAGTCTCCTGGATGCCTGGTTC 0: 1
1: 0
2: 4
3: 26
4: 235
Right 989214000 5:38884897-38884919 CTAAGGGCAGCAGTAACGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 82
989213990_989213999 23 Left 989213990 5:38884850-38884872 CCAGTCTCCTGGATGCCTGGTTC 0: 1
1: 0
2: 4
3: 26
4: 235
Right 989213999 5:38884896-38884918 ACTAAGGGCAGCAGTAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989213990 Original CRISPR GAACCAGGCATCCAGGAGAC TGG (reversed) Intronic
904286398 1:29455451-29455473 GGACCAGGGATCCTGGGGACAGG + Intergenic
904455885 1:30647797-30647819 GGGCCAGGCATCCAGGAGTGAGG - Intergenic
907542678 1:55230265-55230287 GAACCAGCTATCCAGGAGCAGGG - Intergenic
907579472 1:55558653-55558675 GATGCAGGCATCCAGGAGAAGGG - Intergenic
907867974 1:58417354-58417376 AGACCAGGCATCCAAGAGGCAGG - Intronic
908327885 1:63041765-63041787 GAACAAGGCATACAGGTGAAGGG + Intergenic
914844783 1:151276602-151276624 GAAATAGGCATTCAGGAGAGAGG - Intergenic
914912481 1:151799069-151799091 GAACCAGGCAGACAGGAGAGTGG - Intergenic
915464672 1:156089903-156089925 GACCCAGGCGTCCAGGAGGCGGG + Intronic
915498155 1:156295441-156295463 GAACCGGGCATCCAGGGGCTAGG - Intronic
915896309 1:159813750-159813772 GAGCCAGGGCTGCAGGAGACGGG + Intronic
916901037 1:169224124-169224146 GACCAAGGCATCCAGGTGAGAGG - Intronic
920047469 1:203142753-203142775 GGACAAGGCCTCCAGGAGACGGG - Intronic
920352207 1:205344489-205344511 GAACCAAGCACCCAGATGACGGG + Intronic
920534633 1:206729562-206729584 GAACCAGGCAGCAAGGACGCAGG - Intronic
920649827 1:207828614-207828636 GACACAGGCATTCATGAGACAGG + Intergenic
922798636 1:228353751-228353773 GAACAAAGCATCCGGGAGCCTGG - Intronic
923045176 1:230350488-230350510 GAAGAAGGCATCCTGGAAACAGG + Intronic
923997511 1:239512129-239512151 GAAACAGGAACCCAGGAAACAGG + Intronic
924208015 1:241734175-241734197 GAAGGAGGCTTCCAGGACACAGG - Intronic
924928195 1:248704107-248704129 TAAGGATGCATCCAGGAGACAGG + Intergenic
1063381575 10:5589223-5589245 GAACCTGCCCTCCTGGAGACTGG - Intergenic
1065855410 10:29826274-29826296 GAACCAGGCTTACAGAGGACAGG - Intergenic
1069917063 10:71793685-71793707 GAAGCAGGGAGCGAGGAGACAGG - Intronic
1070963587 10:80516081-80516103 GAACGAGGGATCCAGGAGGCAGG - Intronic
1072626646 10:97116533-97116555 TCACCAGGCATAGAGGAGACAGG - Intronic
1074208544 10:111305816-111305838 GAACCAGGCAGGCAGAGGACAGG + Intergenic
1076750389 10:132539213-132539235 CACCCAGGCATCCAGGAGCTGGG - Intronic
1077348008 11:2073261-2073283 GAGCCAGGCATTAAGGACACAGG + Intergenic
1077947845 11:6921677-6921699 GAACCAAGAATCAGGGAGACAGG - Exonic
1078533020 11:12151598-12151620 CATGCAGGCATCCAGGGGACTGG + Intronic
1081539233 11:44018048-44018070 GAGCCAGGGATCCAGGGGACTGG + Intergenic
1082713537 11:56585079-56585101 TAACCAGGCTTCCATGATACTGG - Intergenic
1083267055 11:61551617-61551639 GGAGCAGGCATCCAGGGGATTGG - Intronic
1083603283 11:63961882-63961904 TTGCCAGGCATCCAGGGGACAGG - Intergenic
1083828831 11:65218172-65218194 CAAGCTGGCATCCAGGAGCCAGG - Intergenic
1084477053 11:69394996-69395018 GAGCCAGGCAGCCAGGAACCAGG - Intergenic
1085363100 11:75910690-75910712 GAGCCAGCTATGCAGGAGACTGG + Intronic
1085449163 11:76621759-76621781 AAACCAGGGCTCTAGGAGACAGG - Intergenic
1085585308 11:77698018-77698040 TATCCAGCCATCCATGAGACAGG + Intronic
1085710988 11:78829114-78829136 GAACCAGGGACCCAGGAGGAAGG - Intronic
1086106192 11:83150005-83150027 GGACCAGGCAACCAGAAGACAGG - Intergenic
1086433552 11:86759273-86759295 CAACTAGGCATTCAGGAGCCAGG - Intergenic
1086453582 11:86940502-86940524 GAAGAAGGCAAGCAGGAGACAGG - Intronic
1088921257 11:114261139-114261161 GAGCCAGGGACCCAGGAGCCTGG + Intronic
1089184579 11:116606217-116606239 GGAACAGGCATGCAGGAAACAGG - Intergenic
1089465129 11:118679947-118679969 GAACCTGGCATCCAGGTTACAGG - Intergenic
1090654245 11:128830722-128830744 GACTCAGGCCTCCGGGAGACAGG + Intergenic
1092238313 12:6823017-6823039 GACCCCTGCATCCAGGAGACCGG + Intronic
1092817753 12:12326136-12326158 AACCAAGGCATCCCGGAGACTGG + Exonic
1096228365 12:49883480-49883502 AAAGCAGGCATCCAGGGGAAGGG + Intronic
1096795815 12:54076983-54077005 GGTCCAGGGAGCCAGGAGACTGG + Intergenic
1102464463 12:113120374-113120396 GAACCAGGGAGGCAGGTGACAGG - Intronic
1102905722 12:116673877-116673899 GAACCAGTGAAGCAGGAGACGGG - Intergenic
1103718864 12:122962673-122962695 GTGCCAGGCATGCAGTAGACAGG - Intronic
1103742395 12:123099660-123099682 GAGCCAGGCATCCAGGAGCCAGG - Intronic
1107705126 13:43095147-43095169 TAGCCAGTCATCCAGGAGGCTGG + Intronic
1110570031 13:76992785-76992807 TAACCAGGACTGCAGGAGACGGG - Intronic
1114598417 14:23934009-23934031 GAACCAGTCAGCCAGGAGCTTGG - Intergenic
1115235053 14:31201212-31201234 GAACCAAGTAACCAGGAGACAGG + Intronic
1116865894 14:50031329-50031351 GGACCAGGAATCCAGGTGTCAGG - Intergenic
1118739417 14:68728392-68728414 GAACAAGGCATCAAGGAGAACGG - Intronic
1121219366 14:92274445-92274467 GTCCCAGGCAGCCAGGAGCCTGG - Intergenic
1121672984 14:95727399-95727421 GAAGCAGGCATTCAGCAGTCAGG + Intergenic
1122790574 14:104182609-104182631 GCACCAGGTTTCCAGGACACAGG - Intergenic
1122881061 14:104690586-104690608 GAACCAGGAACCCAGGAACCGGG + Intronic
1126087182 15:45021673-45021695 GAACCAGCTATGCAGGAGACTGG - Intergenic
1126097950 15:45102378-45102400 GCACCAGGCAGCCAGGTGCCAGG + Intronic
1126984518 15:54288763-54288785 TTACTAGGCTTCCAGGAGACGGG + Intronic
1127394882 15:58536643-58536665 GAAGCAGGCTTCCAGGAGTGAGG + Intronic
1128699206 15:69791846-69791868 ATCCCAGGCATCCAGAAGACTGG + Intergenic
1132071691 15:98783316-98783338 TAACCAGGCATGAAGGAGAGAGG - Intronic
1132589367 16:719999-720021 GTTCCAGGCCCCCAGGAGACAGG + Intronic
1133365484 16:5205773-5205795 GAACAAGGCTTGCAGCAGACAGG + Intergenic
1133430983 16:5736522-5736544 GGCCCAGGCATCCAGGAAACAGG - Intergenic
1134094904 16:11412833-11412855 GAACCAGGCAGTCAGGTGAGGGG - Exonic
1134327592 16:13221098-13221120 GAAAAAGGCGTCCAGGAGCCTGG - Intronic
1134387769 16:13789917-13789939 AAACCAGGCATCCTGGATCCAGG - Intergenic
1135172640 16:20200219-20200241 GAACCAGGCTTAGAAGAGACAGG + Intergenic
1135615221 16:23905435-23905457 GAACCAGGCATCCTGTTAACTGG - Intronic
1137616546 16:49851549-49851571 GAACCAGGAAGGCAGGAAACTGG - Intronic
1139801517 16:69526823-69526845 GGGCCTGGCACCCAGGAGACAGG - Intergenic
1141297448 16:82783153-82783175 GAAACAGGCTTCCAGGAGCATGG + Intronic
1141711383 16:85701208-85701230 GCACCAGGCTTCCATGAAACTGG + Intronic
1142804396 17:2363837-2363859 GGACCTGGCATCCAGGAGGCTGG + Intronic
1142956539 17:3526865-3526887 GAACCAGGCATCCGAGAGGATGG + Exonic
1143502239 17:7346305-7346327 GGCCCAGGCATCCAGGACCCAGG - Intronic
1144049614 17:11487288-11487310 GCATCAGGCATCCAGGGGAATGG + Intronic
1144800383 17:17922144-17922166 CAGCCAGCCATCCAGGACACAGG + Intronic
1145208752 17:20997932-20997954 GAACAAGGCCTCCAGGAGGCGGG - Intergenic
1147155991 17:38544728-38544750 GCACCAGGCTCCCAGGAGAGTGG + Intronic
1147170729 17:38617301-38617323 GGGCCAGGCATCCAGCAGTCAGG + Intergenic
1147884514 17:43675787-43675809 GCACAAGGCATCCAGAAGCCAGG + Intergenic
1150217656 17:63479348-63479370 AAACCAGGCAGCCAGGAGGAAGG - Intergenic
1150472088 17:65446163-65446185 GAGCCTGGCATCCAGTAGACAGG - Intergenic
1151078145 17:71297746-71297768 GAACCAGGCAGCCGGGAGGACGG - Intergenic
1151422920 17:74010176-74010198 TAACCAGGCATTCAGAAGACTGG - Intergenic
1152573334 17:81129920-81129942 GAACCTGTCCTCCAGGAGATGGG + Intronic
1152799556 17:82324438-82324460 GAGCCGGGCTGCCAGGAGACAGG - Intronic
1153949406 18:10045539-10045561 GAACCAGGCCTGGAGGCGACAGG + Intergenic
1154123684 18:11671611-11671633 AAACCAGACACCCAGGAGGCAGG - Intergenic
1154322828 18:13368403-13368425 AAAGCAGGCATCCCTGAGACAGG - Intronic
1156499822 18:37550650-37550672 GACCCAGGCAGCCAGCGGACGGG - Intronic
1156551517 18:38024056-38024078 GATCCACTCATCCAGGAGAGGGG - Intergenic
1156674178 18:39507632-39507654 GAACCAGCTGTGCAGGAGACTGG - Intergenic
1158324808 18:56302467-56302489 GAACCAGGCCACAAGGAGAGAGG - Intergenic
1160145091 18:76357179-76357201 GAACCAGCCATCCAAGAGGAGGG + Intergenic
1161112467 19:2477837-2477859 GACCCAGGCCAGCAGGAGACAGG + Exonic
1161470924 19:4456466-4456488 CAGCCAGGCAGCCAGGACACGGG - Intronic
1162551750 19:11361915-11361937 GAACAAGGCCCCCAGGAGAGGGG - Intronic
1162597360 19:11639740-11639762 CAATCAGGCGTCCAGGAGGCTGG + Intergenic
1163790269 19:19302257-19302279 GAACCAGGCATTCAGGTAAGGGG - Exonic
1165479578 19:36054735-36054757 TAATCAGGCATCCAGTACACTGG + Exonic
1166524877 19:43504586-43504608 CACCCAGGGATCCAGGAGTCGGG + Exonic
1166716038 19:44968543-44968565 CACCCAGGCCTGCAGGAGACTGG - Intronic
1167340667 19:48913920-48913942 GAACCAGGCCTCCAGAAGCCTGG + Intronic
1167805920 19:51785239-51785261 GAGCCAGCTATGCAGGAGACTGG - Intronic
925180821 2:1815876-1815898 GCTCCAGGCATCCAGGTGAGAGG + Intronic
926144005 2:10385847-10385869 GAACCAGGCGTCCAGGGCAGTGG - Intronic
928148848 2:28808142-28808164 GAACCTAACATCCAAGAGACAGG - Intronic
929548701 2:42875323-42875345 TAACCAGGCAACCAGGACAGGGG - Intergenic
931982062 2:67704446-67704468 GAACCAGGCATCCCTTAGTCAGG - Intergenic
933635555 2:84704897-84704919 CCACCAGGCTTCCAGGAGACAGG + Intronic
934992876 2:98933729-98933751 GTACCAGGCCTCCAGGAGGGTGG - Intronic
935581337 2:104758405-104758427 AAGCCAGGCAGCCAGGAGAGAGG + Intergenic
936259777 2:110948819-110948841 GCACCAGGCAAGCAGCAGACTGG + Intronic
937915635 2:127097470-127097492 GAAGCAGGCATGCATGGGACAGG + Intronic
938446848 2:131387149-131387171 GAGCCAGGTGTCAAGGAGACTGG - Intergenic
941493082 2:166166649-166166671 TAACCAGGCATCCAGCCCACTGG - Intergenic
942564330 2:177251482-177251504 GTACAAGGAATCCAGCAGACAGG + Intronic
942938248 2:181584683-181584705 GATACAGGCAAGCAGGAGACAGG - Intronic
944802293 2:203248194-203248216 CAGCCAGGCAGCCAGGGGACAGG + Intronic
945176505 2:207048812-207048834 CAACCTGGCCTCCAGGAGATAGG + Intergenic
945423834 2:209674024-209674046 GACCTATGCATCCAGGAAACTGG + Intronic
946023571 2:216658232-216658254 AAACCAGACATCCAGAAGCCAGG + Intronic
946755396 2:222940365-222940387 GAGCCTGGTATCCAGGAGAAAGG - Intronic
1170568200 20:17618345-17618367 GGACCAGGTAGCCAGGGGACGGG + Intronic
1170796377 20:19551045-19551067 GAAACAGGCATCTAGGAGTTAGG - Intronic
1170876472 20:20254358-20254380 GAACCTGGCAGGCAGGTGACAGG - Intronic
1172652650 20:36515005-36515027 GAAACTGGCATCCAGGAGAGAGG + Intronic
1172998767 20:39090746-39090768 GAAGAAGCCATCCAGGAGAGCGG - Intergenic
1173499377 20:43541030-43541052 GGAAAAGGCATCCTGGAGACAGG + Exonic
1173729542 20:45318731-45318753 GAAGCAGGCAGCCAGGAGGGAGG + Intergenic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1174492008 20:50906503-50906525 GAGCCACTCATCCAGGAGGCAGG - Intronic
1175721186 20:61288424-61288446 GACCCAGCCATCCATAAGACTGG - Intronic
1175860436 20:62147612-62147634 GATCCAGACACCCAGCAGACAGG - Intronic
1176134711 20:63517320-63517342 GAGCCAGCCATGCAGGAGGCAGG - Intergenic
1176428470 21:6562618-6562640 CACCCTGGCATCCAGGTGACAGG - Intergenic
1177700762 21:24636211-24636233 GAACCAGCTGTGCAGGAGACTGG - Intergenic
1179029863 21:37711303-37711325 GAAGCAGGCATCCTGGGCACAGG - Intronic
1179703960 21:43170934-43170956 CACCCTGGCATCCAGGTGACAGG - Intronic
1179886779 21:44317573-44317595 GCATCAGGCATCCAAGACACTGG - Intronic
1180039307 21:45267934-45267956 GAACCAGGGATCAAGAAGAAAGG + Intronic
1184084081 22:42247821-42247843 GAACCAGTCAAGTAGGAGACAGG - Intronic
1185178649 22:49346750-49346772 GGACCAAGTCTCCAGGAGACGGG - Intergenic
951897538 3:27624529-27624551 GAATCAGGAATTCAGGAGAGAGG + Intergenic
952144678 3:30518863-30518885 GAATGAGACATTCAGGAGACAGG - Intergenic
953872144 3:46635887-46635909 GAAACAGGAATACAGGAAACAGG - Intergenic
953880958 3:46691093-46691115 GACCCAGGCCCCCAGGACACAGG + Intronic
954039066 3:47870705-47870727 GAAGCAGGCAGTCAGGACACTGG - Intronic
954549832 3:51472034-51472056 GAAGCAGGAAGCAAGGAGACTGG - Intronic
955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG + Intergenic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
956151359 3:66246619-66246641 GAAACAAGTATCCATGAGACTGG + Intronic
959086613 3:101856978-101857000 GAATCAGACATTCAGGAGACTGG + Intronic
960936483 3:122907121-122907143 GAACCAGGCATCCAGTAGAATGG - Intergenic
961109319 3:124270634-124270656 GACCCAGGCTTCCAGGCCACTGG - Intronic
961219248 3:125187002-125187024 ACATCAGGCATCCAGGAGGCGGG + Intronic
961793489 3:129393163-129393185 GAAGCAGGCAACCAGGAGGTAGG - Intergenic
961807486 3:129499781-129499803 GAAGCAGGCAACCAGGAGGTAGG - Intronic
962129081 3:132653202-132653224 GAAACAGCCATCCAAGAGAATGG - Intronic
962976693 3:140452106-140452128 GAGCCAGGTATCCAGGAGCAAGG + Intronic
963542911 3:146617312-146617334 GAAATAGTCATCTAGGAGACTGG - Intergenic
963935031 3:151043536-151043558 GAAAGAGGAATCCAGGAAACGGG - Intergenic
964324514 3:155532163-155532185 GAAAATGGCATCCAGGAGGCAGG + Intronic
965627546 3:170696688-170696710 GTGCCTGGCATCCAGGAGCCTGG + Intronic
967874933 3:194261850-194261872 GAACAAGGCCTCCAGGCTACAGG - Intergenic
968193859 3:196690893-196690915 GAATCAGGCACCTAAGAGACGGG + Intronic
968801225 4:2744386-2744408 GCACCAGGTGTCCTGGAGACAGG - Exonic
969029319 4:4198653-4198675 CAAGCAGGCATGCAGGAGACAGG + Intronic
969298900 4:6285681-6285703 GACCCAGGTGTACAGGAGACAGG - Intronic
969407991 4:7007685-7007707 GAAGCAGGGTTCCAGGAAACAGG - Intronic
970272714 4:14364528-14364550 TAACCAGGCATCCTGGAGGCTGG - Intergenic
970516875 4:16840885-16840907 GGACCAGGCAGCCATGAGCCAGG - Intronic
970938103 4:21598508-21598530 AAACCAGGCAGGCAGCAGACTGG + Intronic
971352433 4:25865304-25865326 GCACCAGGCATGCAGAAAACCGG + Intronic
972326921 4:38025478-38025500 GAATTAGGCATCCTGCAGACAGG + Intronic
972344378 4:38180527-38180549 GAACCATGGCTCGAGGAGACTGG + Intergenic
977161939 4:93645619-93645641 GACCCAGGTATCCAGGAGACAGG - Intronic
978203389 4:106049603-106049625 GAACCAGGCATCTAGGGTATAGG + Intronic
978374836 4:108064101-108064123 CAACCAGGATTCCAGGTGACAGG + Intronic
981763047 4:148215173-148215195 AAACAAGGCATCCAGAATACAGG + Intronic
983776092 4:171609409-171609431 GATCCAGGCAGCCAGCAGACAGG - Intergenic
984150321 4:176122142-176122164 GGAACAGGAAGCCAGGAGACAGG - Intronic
984475125 4:180225550-180225572 GAACACGGCAGACAGGAGACAGG - Intergenic
986430791 5:7679251-7679273 GAACCAGCCATCCAGGTCCCGGG + Intronic
987331916 5:16864571-16864593 GAACCAGGTTCCCAGGAGAAAGG + Intronic
988673485 5:33407206-33407228 GAACCAGGCATTTTGGAGAGGGG + Intergenic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
990352264 5:54930730-54930752 AAAACAGGCATTCAGGAGAAAGG + Intergenic
992853341 5:80834057-80834079 GAACCAGTCATCAAGGCTACTGG - Intronic
995165875 5:109041053-109041075 GAAGCAGTCATCCAGAAAACTGG + Intronic
997432618 5:133851242-133851264 GGACCAGGGAACCAGAAGACAGG + Intergenic
998449239 5:142221452-142221474 GAACAAGACAAACAGGAGACAGG + Intergenic
999325899 5:150643167-150643189 GAACCGGCCAGCCAGGAGCCTGG + Intronic
1001143194 5:169162311-169162333 TAACAAGTCCTCCAGGAGACTGG + Intronic
1001191918 5:169639205-169639227 TAACCAGGCAGTCAGCAGACAGG - Intronic
1002643628 5:180642268-180642290 AAACCAAGCATTCAGGAGGCAGG - Intronic
1003047874 6:2751426-2751448 GGCACAGGCATCCAGGAAACAGG + Intergenic
1003236467 6:4299760-4299782 GAACAAAGCAACCAGGAGAAAGG + Intergenic
1003256834 6:4482529-4482551 GTACCAGGCATCCAGATGGCTGG + Intergenic
1006187144 6:32187962-32187984 CCACCTGGCATCCAGGAAACGGG + Exonic
1008414091 6:51219214-51219236 AAACCAGGTATCTAGGGGACAGG - Intergenic
1010254499 6:73742495-73742517 GAACCAGGCTTCTGGGAGCCAGG + Intronic
1010751433 6:79620130-79620152 GAACCAGGCTTCTATGAGAACGG - Intergenic
1015257853 6:131200056-131200078 GAACCAGGTATACCGGGGACTGG + Intronic
1015268101 6:131309031-131309053 TAGCCAGGCATTCAGGAGGCTGG - Intergenic
1017707717 6:157139433-157139455 GCACCAGGCACCCTGGAGAAGGG + Intronic
1019603053 7:1894896-1894918 GAACCAGGCACCCAGCAGTGGGG + Intronic
1019717989 7:2550043-2550065 GTCCCAGCCATCCAGGAGGCTGG + Intronic
1023491599 7:40748754-40748776 GAAACAGGATTCCAGGATACTGG - Intronic
1026996001 7:74617199-74617221 GCAGCAGGCATCCAGGAGACCGG + Intergenic
1027250903 7:76398041-76398063 GTCCCAGGCTGCCAGGAGACAGG - Intronic
1027592049 7:80130080-80130102 GAACCAGACAACAAGGAGAATGG + Intergenic
1028347395 7:89799101-89799123 GAATGGGGCATCCAGAAGACTGG - Intergenic
1030202327 7:106918258-106918280 GAATCAGGAAGCCAGGAGGCTGG - Intergenic
1031052356 7:116956557-116956579 CAATCAGGCAGCCAGGAGCCAGG + Exonic
1031390099 7:121203296-121203318 GACCCAGGCTCCCAGGAGAAAGG - Intronic
1035188358 7:157143486-157143508 GAGCCAGGAATGAAGGAGACAGG - Intronic
1038040387 8:23719220-23719242 GAGTCAGGCATTCAGGAGACAGG + Intergenic
1038528599 8:28297984-28298006 GAACCAGGCATACTGGACATAGG - Intergenic
1042216119 8:66430768-66430790 GTACCAGGTATCCAGGTAACCGG - Intronic
1042792453 8:72623629-72623651 GAACCAGGCTCCCAGCACACAGG + Intronic
1043457731 8:80429120-80429142 GAATCAGGAATCCAGGTGTCGGG - Intergenic
1044526751 8:93261053-93261075 GTAGCAGGCATCCAGTAGCCAGG + Intergenic
1048269908 8:133020318-133020340 GTACCTGGCCTCCAGGTGACAGG + Intronic
1049129810 8:140828309-140828331 GGACCAGTCATGGAGGAGACAGG + Intronic
1049439974 8:142604861-142604883 GGGCTAGGCATCCATGAGACTGG + Intergenic
1055512020 9:77004376-77004398 GAACCAGGAATTTAGGAGAGAGG - Intergenic
1055927652 9:81527128-81527150 GAAACAGGCCTCCTGGAGAGTGG - Intergenic
1056755800 9:89381382-89381404 CAAGCAGGCATCCAGGAGCATGG + Intronic
1057230659 9:93319589-93319611 AAACCAAGCCTCCTGGAGACAGG - Intronic
1058611355 9:106779637-106779659 GAATCAGGATTCCAGGAGGCAGG - Intergenic
1058651448 9:107178862-107178884 AAACCAGGAAGCCAGGAGAGAGG - Intergenic
1060224029 9:121780624-121780646 GGACAAGGCATCTAGGAGACAGG + Intronic
1060258445 9:122053156-122053178 CCACCAGGAATCCAGGAGCCGGG + Intronic
1060792701 9:126496958-126496980 GACCCAGGCTTGGAGGAGACAGG + Intronic
1061701648 9:132420769-132420791 GTACCAGGCACCAAGGATACAGG + Intronic
1185708849 X:2286210-2286232 GACCCAGGCCTCCAGCACACGGG + Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1187980229 X:24748711-24748733 GAATCATGGATCCAGGAGAATGG + Intronic
1188058059 X:25564490-25564512 GAGCTAGGGATCCAGGAGAAAGG - Intergenic
1189418057 X:40832108-40832130 GCACCAGGTGTCCTGGAGACAGG - Intergenic
1189515879 X:41713035-41713057 GAACCAGCCGTGCAGGAGAGCGG - Intronic
1190525860 X:51328958-51328980 GATCCAGGCACCCAAGAGAATGG - Intergenic
1192579621 X:72270343-72270365 GGACCCTGCATCCAGGTGACTGG + Intronic
1193179995 X:78443044-78443066 GAGCCAGCTAACCAGGAGACTGG + Intergenic
1193765228 X:85520253-85520275 GAACCAGGAATTGAGGACACAGG + Intergenic
1194889617 X:99362577-99362599 GAAACAGTCATCCAGGTGAGTGG + Intergenic
1196777706 X:119355502-119355524 GAAAAAGTCATCCAGGAGAGTGG + Intergenic
1197152889 X:123239302-123239324 GAACCAGGCACTGAGGAAACAGG - Intronic
1197155334 X:123264186-123264208 CCACCAAGCATCTAGGAGACAGG + Intronic
1198986637 X:142462409-142462431 TAAACAGGCATCCAGAAGAAAGG + Intergenic
1200954396 Y:8929739-8929761 GAAACAGCCATCCAGGGTACTGG - Intergenic
1200958183 Y:8972066-8972088 GAAACAGTCATCCAGGGTACTGG - Intergenic