ID: 989214238

View in Genome Browser
Species Human (GRCh38)
Location 5:38887671-38887693
Sequence CAGTTTTACATAAAAGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989214238_989214241 16 Left 989214238 5:38887671-38887693 CCATACTCTTTTATGTAAAACTG 0: 1
1: 0
2: 4
3: 32
4: 301
Right 989214241 5:38887710-38887732 ATTCTATGAAAACCCCTCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 141
989214238_989214243 27 Left 989214238 5:38887671-38887693 CCATACTCTTTTATGTAAAACTG 0: 1
1: 0
2: 4
3: 32
4: 301
Right 989214243 5:38887721-38887743 ACCCCTCCTGGGCTTTTCATGGG 0: 1
1: 0
2: 2
3: 7
4: 184
989214238_989214240 15 Left 989214238 5:38887671-38887693 CCATACTCTTTTATGTAAAACTG 0: 1
1: 0
2: 4
3: 32
4: 301
Right 989214240 5:38887709-38887731 AATTCTATGAAAACCCCTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 130
989214238_989214242 26 Left 989214238 5:38887671-38887693 CCATACTCTTTTATGTAAAACTG 0: 1
1: 0
2: 4
3: 32
4: 301
Right 989214242 5:38887720-38887742 AACCCCTCCTGGGCTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989214238 Original CRISPR CAGTTTTACATAAAAGAGTA TGG (reversed) Intronic
901073424 1:6535976-6535998 CAGTTATAATTAAAAGAGCATGG + Intronic
907236874 1:53057684-53057706 CAGTTCTACATAAAAGTTTATGG - Intergenic
909160246 1:72138104-72138126 CAGATATACATAAAGGAATAAGG + Intronic
909367327 1:74842688-74842710 CAGAGGTACATAAAAGAATATGG + Intergenic
910540650 1:88352371-88352393 GAGCTTTACATAACAGAGTTGGG + Intergenic
911280742 1:95924862-95924884 CACTTTTACACAAAAGAATTTGG - Intergenic
911517586 1:98886356-98886378 CGGTTTTAGATAACAGAGTATGG - Intergenic
911589808 1:99733655-99733677 CAGTGTTATATAAAAGGGAAAGG + Intronic
911747371 1:101454508-101454530 CTGTTTTACATAAAAGCAAATGG - Intergenic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
914731255 1:150372648-150372670 CAGTTTTACATTAAATGGTAAGG + Intronic
915621095 1:157084836-157084858 CACTTTTACCAATAAGAGTACGG - Intergenic
915683014 1:157600653-157600675 TAGATTTATATAAAATAGTAAGG + Intergenic
916087757 1:161283280-161283302 CAGTTTTACATAGAGTAGTCAGG - Intronic
917556838 1:176099449-176099471 CAGTCTTTAATAAATGAGTATGG + Intronic
917885846 1:179383858-179383880 TAGTGTTACATAAAATAATAAGG - Intronic
918686095 1:187417795-187417817 AAGTTATACATCAAAGAGTATGG + Intergenic
919334138 1:196210218-196210240 CAGTTATGCAGAAAAAAGTAAGG - Intergenic
919463724 1:197908511-197908533 CAGTTTTCCAGAAAAGCATAGGG + Intergenic
921526884 1:216228853-216228875 AAGTTTTATATAAATGAGTTTGG - Intronic
923044671 1:230346974-230346996 AAGTTTTACAATAAAGAGTTGGG - Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
924268839 1:242310932-242310954 GAGTTTCACATAAAAGATTCTGG - Intronic
1063600016 10:7472629-7472651 CAGTTTGGCAAAAGAGAGTAAGG - Intergenic
1065473425 10:26107759-26107781 CAATTAAAGATAAAAGAGTAAGG - Intronic
1066411914 10:35179725-35179747 CAGTTTTTCCTAAAAGAGAATGG + Intronic
1066716071 10:38287836-38287858 GAGTTTCACATAAAAGATTTTGG + Intergenic
1067304656 10:45050483-45050505 CTGTTTTACATAGAAGAACAAGG - Intergenic
1067357392 10:45542622-45542644 GAGTTTTGAATAAGAGAGTATGG + Intronic
1068164644 10:53313139-53313161 AAAATTTACATAAAAGAATATGG + Intergenic
1071752005 10:88489893-88489915 CAGTAATTCATAAAAGAGTTAGG - Intronic
1073865350 10:107797203-107797225 CAGGTTTACATGAAATACTATGG - Intergenic
1074990992 10:118707759-118707781 CAGTTTTACATAGCAGATTTTGG - Intronic
1077723315 11:4648675-4648697 CAGTTTTACATAAACAGATATGG - Intronic
1080308243 11:30860016-30860038 CAGTTTTCCCTAGAAGAGAATGG - Intronic
1080724892 11:34887238-34887260 CAGTTTTTCTGAAAAGAGTTTGG - Intronic
1081411989 11:42770525-42770547 CATTTATACACAAAACAGTAGGG - Intergenic
1081943775 11:46969342-46969364 CAGTTTTATATAACAGAAGATGG + Intronic
1085999217 11:81958992-81959014 AAGTTATAAATTAAAGAGTATGG + Intergenic
1086726588 11:90193027-90193049 CAGTTTAACTTAAAACAGTGGGG + Intergenic
1087621091 11:100543177-100543199 TAGTTTTAAATAATAGAATATGG + Intergenic
1087684745 11:101250039-101250061 CAGTTTTAAAAATAAGATTAAGG + Intergenic
1089428096 11:118397149-118397171 CAGATTTTCATAAGAGAATAAGG - Exonic
1091324428 11:134675457-134675479 GAGTTGTTCATAAAAGAGTAAGG - Intergenic
1091529066 12:1337114-1337136 CAGTATTAGATCAAAGATTAAGG - Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1093108250 12:15116058-15116080 CAATTTAACATAAAAGAGTAGGG - Intronic
1093124836 12:15315697-15315719 TAGTTTTATGTAAAAGAGTCTGG + Intronic
1093384898 12:18541075-18541097 GAATTTAACATAAAAGAGTCGGG - Intronic
1093811811 12:23500940-23500962 CAGTATTATATAGAAGAGCATGG - Intergenic
1095724000 12:45432335-45432357 CATTTTTACAAACAATAGTATGG + Intronic
1096329249 12:50695300-50695322 CAGGTTTTCATAACAGAGTAGGG - Exonic
1096606669 12:52771478-52771500 CAGTCTTGCAAAAAAGATTAGGG - Intronic
1096919760 12:55071608-55071630 CAGTTTCACATAAATGAGCTAGG + Intergenic
1097462648 12:59881369-59881391 CAGTTTGACATTAAAGAGAATGG - Intergenic
1098453273 12:70644324-70644346 TAGTTTACCAAAAAAGAGTAAGG + Intronic
1098504385 12:71232362-71232384 CAGTTTTAAATAAGATAGTCAGG - Intronic
1099028032 12:77490680-77490702 CAAATTAACATAAAGGAGTATGG + Intergenic
1099740300 12:86626533-86626555 CAGATTAAGATAAAAGAGAATGG + Intronic
1100048673 12:90416548-90416570 GATTTTTACATATAAGATTATGG - Intergenic
1100517411 12:95341759-95341781 CAGTGCTACATGAAAGAGTCAGG + Intergenic
1101459298 12:104873600-104873622 CAGTTTTATGGAAAACAGTATGG - Intronic
1101540186 12:105658085-105658107 CAGTTTGAGGTAAAAGGGTAAGG + Intergenic
1101887932 12:108684539-108684561 CATATTTACATAAAAGTTTAAGG + Intronic
1102579844 12:113879394-113879416 CATTTTTACAGAAAAGAGTATGG - Intronic
1102778417 12:115541775-115541797 AAGTTTTGCAGAAAAGAGTTGGG - Intergenic
1105045133 12:132996834-132996856 CAGTTTTAAACAAAACAATAAGG - Intronic
1105411474 13:20174902-20174924 CAGGTTTTCTTAAAAGAGCATGG - Intergenic
1107165557 13:37278781-37278803 CATTATTAAAAAAAAGAGTATGG - Intergenic
1107400392 13:40063637-40063659 GAGTTTTACATGGAAGAGGAGGG - Intergenic
1107653643 13:42569912-42569934 CAGATTTTCAAAAAAAAGTAGGG - Intronic
1107956206 13:45514532-45514554 CAGAATTAGATAAAAGAGGATGG - Intronic
1109032040 13:57203899-57203921 CAGTGTTAGATAGCAGAGTACGG + Intergenic
1109412566 13:61992227-61992249 CATATTTACGTAAAAGAGTAAGG + Intergenic
1109540528 13:63772798-63772820 AATTTATACATAAAAGAGTTTGG + Intergenic
1110106272 13:71680056-71680078 CAGTTAAACATAAATGAGCAAGG + Intronic
1111107550 13:83667331-83667353 TAGTTTTACTTGAAAAAGTATGG - Intergenic
1111122463 13:83871677-83871699 CAGGTTAAGATAAAAGATTATGG - Intergenic
1111806432 13:93044347-93044369 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
1112747018 13:102537971-102537993 CAGATTTACATTAAAGAATCTGG + Intergenic
1114702646 14:24694402-24694424 CATTTTTACATATAAGACAATGG + Intergenic
1114877723 14:26742528-26742550 ATGTATTACATAAAACAGTAAGG - Intergenic
1114981007 14:28164468-28164490 CATTTAGACATAAAAGATTAAGG - Intergenic
1115604914 14:34991534-34991556 CAGTTTTAAATAAGTGATTAGGG + Intronic
1120177668 14:81312377-81312399 CAGGTGTAGATAAGAGAGTATGG - Intronic
1120382629 14:83800642-83800664 CTGTTTGAAATAAAAGAGAAGGG - Intergenic
1121480681 14:94269370-94269392 TAGTGTTACATAAAACTGTAAGG + Intronic
1122290020 14:100675633-100675655 CATTTTAAAATAAAAGAATAAGG - Intergenic
1125458150 15:39881500-39881522 CAGTTTTGCATTCAAGTGTAAGG - Intronic
1126341311 15:47644344-47644366 CAATTTTACTTAAATGAATATGG - Intronic
1126429808 15:48570694-48570716 TTGTTTTAAATAAATGAGTATGG - Intronic
1126690484 15:51285457-51285479 CGGTTTTACAAAAAAGAGAAGGG + Intronic
1126826150 15:52550672-52550694 TTGTGTTATATAAAAGAGTAAGG + Exonic
1127115486 15:55722176-55722198 CAGATCTACAGAAAAGTGTAAGG - Intronic
1127261401 15:57329321-57329343 GAGTTTGAAATAAAAGAATATGG + Intergenic
1127742996 15:61931935-61931957 GAGGTTTACAAGAAAGAGTAAGG + Intronic
1127768636 15:62212133-62212155 CAGTTTTACAAAAAAGAAAAGGG - Intergenic
1129531512 15:76269203-76269225 CGGTTTTACAAAAAAGAAAAGGG + Intronic
1131759396 15:95603730-95603752 CATTTTTATTTAAAAGAATAGGG - Intergenic
1133844640 16:9442583-9442605 CCATTTTACAGAAAAGTGTAGGG - Intergenic
1134097841 16:11430891-11430913 CAGGTTTAGATAAAGGGGTATGG - Intronic
1134434113 16:14239093-14239115 CATTTTTACATAACAGTTTACGG - Intronic
1135036821 16:19085782-19085804 CAGTGGTTCATAGAAGAGTATGG - Intergenic
1135224953 16:20647709-20647731 CTCTTTTACAAAAAAGAGAAAGG + Intronic
1137225142 16:46496959-46496981 CACTTTTACATAAAAGTTCACGG + Intergenic
1138332382 16:56225422-56225444 CAGTTTTACAGAAGAGAAAATGG + Intronic
1140520140 16:75574045-75574067 AAGTTTTACTTAAAAGACAATGG + Intronic
1140843757 16:78866828-78866850 CAGTTTTTCTTAAAATAGTAGGG + Intronic
1141337091 16:83166268-83166290 GAGATTTACATAAAATAGTCAGG - Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1144222538 17:13113079-13113101 CAGTCTTAAATAAAAGAGCTAGG + Intergenic
1147541781 17:41366286-41366308 CTTTTTTACATAAAGGAGTGTGG - Intronic
1147752912 17:42747897-42747919 CATTTTGACATAACAAAGTATGG + Intergenic
1150462832 17:65366874-65366896 CAGTTTTACGTAAAACAGTGAGG + Intergenic
1150971857 17:70037705-70037727 AAGTTTTCCATAAAAGAGAAAGG - Intergenic
1151375168 17:73683534-73683556 CAGAATTACAGCAAAGAGTAGGG - Intergenic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1154482127 18:14840978-14841000 CAGGTTTACATAATGGAGAATGG + Intronic
1158102616 18:53847177-53847199 CAGTTGTATAAAAAACAGTATGG + Intergenic
1158354649 18:56604189-56604211 CAGTTTCATATAAAAGAATGTGG + Intronic
1159682267 18:71369626-71369648 CAGTTTTAAGTAAAAAAATAAGG + Intergenic
1160446886 18:78934913-78934935 CAGTTTTTCATCGAAGAGTCTGG - Intergenic
1162072777 19:8164672-8164694 CAGGTTCAGATAAAAGATTATGG - Intronic
1164108221 19:22128309-22128331 AACTTTTCCATAAAAGAATAAGG - Intergenic
925437496 2:3852941-3852963 CCCTTTTACAGAAAAAAGTATGG + Intergenic
929615396 2:43303180-43303202 GTGTTTTGCATAAAGGAGTATGG + Intronic
929622218 2:43366694-43366716 CTGTTTTCCATAAAAATGTAGGG - Intronic
930522136 2:52480835-52480857 CACTTTTATATAAAAAAGCATGG - Intergenic
931229575 2:60362973-60362995 CAGATTTACTTATTAGAGTAAGG + Intergenic
931484877 2:62680579-62680601 CAGTTTTGCATAAAACAGGAGGG + Intronic
931765915 2:65456474-65456496 AATTTTTACATAGGAGAGTATGG - Intergenic
931947435 2:67325606-67325628 CTGTTTTACAGAAAAGAGCATGG - Intergenic
931966708 2:67543486-67543508 TAGTATTCCATAAAAGGGTAGGG - Intergenic
932251614 2:70249319-70249341 AAGTTTTACTTAAAAAAGTAAGG + Intergenic
932419083 2:71590868-71590890 CAGTGTGACATTAAAGAGGAGGG - Intronic
932709661 2:74052974-74052996 CATTTTTACATAAAGGGGTTGGG - Intronic
933044238 2:77515002-77515024 CAGCTTTTCCTAAAACAGTAAGG - Intronic
933371966 2:81425869-81425891 TAGTTTTACTTAAAAGATAAAGG - Intergenic
933411495 2:81930789-81930811 CAGTTGTAAATAATAGAGGAAGG - Intergenic
933534909 2:83559259-83559281 CTGTTTTTCATAAAAGACTATGG + Intergenic
934111838 2:88750902-88750924 CAGGTTTAAATAAAACAGTGTGG + Exonic
934474421 2:94584540-94584562 TGGGTTTACAAAAAAGAGTAAGG + Intergenic
935368740 2:102322333-102322355 CATTTTTCCATATAAGATTAAGG - Intronic
935414075 2:102796812-102796834 GAGTTTTACAGGAAAGAGGATGG - Intronic
935532078 2:104246110-104246132 CATTTTTACATAAAAATGTCTGG - Intergenic
935902823 2:107810898-107810920 CAGTTTTGCATAAGAAGGTAGGG + Intergenic
937838800 2:126503676-126503698 CAGCTTTAGATAATAGAATAGGG - Intergenic
939155666 2:138522446-138522468 CAGTTTTAAAAAAAAGGGTGGGG - Intronic
939323675 2:140658105-140658127 ATGTTTTACTTAAAATAGTATGG - Intronic
939972974 2:148682944-148682966 CAAATGTACATAAAACAGTATGG - Intronic
940779842 2:157921050-157921072 CAGTTTTATTTATAATAGTAAGG + Intronic
940780226 2:157925481-157925503 AAGTTTTACAGAAATGAGAAGGG + Intronic
941058601 2:160818131-160818153 CATAGTTCCATAAAAGAGTATGG - Intergenic
941323922 2:164089144-164089166 CACTCTTACATAAATGAGTCAGG + Intergenic
942351810 2:175060608-175060630 AAGTTTTAAAAAAAAGACTAGGG - Intergenic
942424052 2:175840555-175840577 CAGTTTTATAAAAAATAGTAGGG + Intergenic
942659410 2:178248178-178248200 CAGATATACAAAAAAGAATATGG - Intronic
942801918 2:179885063-179885085 CAGTTTTAATTAAAGGATTAGGG + Intergenic
942858445 2:180580788-180580810 CTGTTTTATATAAAAAAGGAAGG + Intergenic
942972973 2:181979516-181979538 GAGATTCACATAAGAGAGTATGG - Intronic
943382124 2:187163682-187163704 CAAGATTACAGAAAAGAGTAAGG - Intergenic
943862317 2:192883261-192883283 CAGCTTTAGATCAAAGAGGAAGG - Intergenic
945310733 2:208309299-208309321 CAGTTAAACATAAAAGAATAAGG + Intronic
945622835 2:212163687-212163709 CAGTTATACAAATAAGATTATGG + Intronic
946703395 2:222434700-222434722 CAGTTTTTCATAAAATTTTATGG - Intronic
946997224 2:225407638-225407660 GAGTTTTACATCAAATAGTTGGG + Intronic
947660264 2:231861398-231861420 CAATTTTAAATAAAAAAGGAGGG + Intergenic
948324121 2:237098079-237098101 CAATGGTACATATAAGAGTACGG - Exonic
1170125964 20:12964649-12964671 CAGAGATACATAAAAGAATAGGG + Intergenic
1170385684 20:15813876-15813898 CACTATTACATAAAACAGCATGG + Intronic
1170966169 20:21073624-21073646 CAGTTTTTCATAAAATAATATGG - Intergenic
1171015301 20:21535787-21535809 CACTTTGACAAAATAGAGTAAGG - Intergenic
1172001913 20:31785402-31785424 TAGTTTTACATACAAGATAATGG + Intronic
1174674309 20:52338620-52338642 AAGTTTTACATAAACGATTTTGG - Intergenic
1174956237 20:55101916-55101938 CAGTTTAAGATAAAAGATTGTGG + Intergenic
1175469075 20:59213184-59213206 CATTTTTACATAAAATTGTAGGG - Intronic
1176066311 20:63198062-63198084 CAGTTTTACATTTGAGGGTAGGG - Intronic
1176798479 21:13395646-13395668 CAGGTTTACATAATGGAGAATGG - Intergenic
1177363847 21:20108225-20108247 CACTTTTACACAAAACAGCAAGG + Intergenic
1177841145 21:26235176-26235198 CAGTTTTACAAAAATGGGCAGGG + Intergenic
1177901160 21:26916806-26916828 GAGTTTTTCAAAAAAGAGTTTGG - Intergenic
1178164380 21:29956060-29956082 CTGTTCTAATTAAAAGAGTATGG + Intergenic
1178556746 21:33597916-33597938 CATTTGTACATTAAAAAGTAAGG - Intronic
1182920009 22:34070522-34070544 AAGTTTTAGATAAAAGATTATGG - Intergenic
1183430046 22:37760003-37760025 CAGTTGTGGATACAAGAGTATGG - Intronic
950973888 3:17219499-17219521 CAGTTTTCAATAAAAGTATAAGG - Intronic
951112180 3:18817135-18817157 GAGTTTTACATAAGAGTGAAGGG - Intergenic
952022785 3:29042572-29042594 CAGTTTTATATATAATATTATGG + Intergenic
952643500 3:35626698-35626720 CAGTATTACATAAGTGAATAGGG - Intergenic
953710133 3:45263194-45263216 CAGCTTAACATACAAGGGTAGGG + Intergenic
955132939 3:56188589-56188611 CATTTTTACAGAAAAGGGCATGG + Intronic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
957285802 3:78216183-78216205 TAGTTTTACTTAAAAGAATCAGG - Intergenic
957805703 3:85145949-85145971 CAGTTTGGCATAAAAGGTTAAGG + Intronic
959270706 3:104206268-104206290 CAATTTTACATAAAAGTTTATGG + Intergenic
959467441 3:106705146-106705168 CATTTTGATATAAAGGAGTAAGG + Intergenic
960281765 3:115788230-115788252 CTATTTTACATAAAAGAAAATGG - Intergenic
960727914 3:120689679-120689701 CATTTTTCCATTAAAGGGTAAGG + Exonic
961725251 3:128924093-128924115 CGGTTTTACAAAAAAGAAAAGGG + Intronic
963845350 3:150150125-150150147 CAGTGTTAATTAAAATAGTAAGG + Intergenic
964016828 3:151957982-151958004 CACTTCTACAAAAAAGATTAAGG + Intergenic
965049247 3:163623116-163623138 TTGTTTTACATATAACAGTAAGG + Intergenic
965174467 3:165313880-165313902 TAGTTTTCAATAAAAGAGAAAGG - Intergenic
966978071 3:185103942-185103964 CAGTTATACAAACAAGAGAAAGG + Intronic
967513947 3:190344959-190344981 GACTTTTACTTAGAAGAGTATGG + Intronic
967550148 3:190783798-190783820 CCATTTTACATAAAAGACTTGGG + Intergenic
968388144 4:163477-163499 AACTTTTACATGAATGAGTAAGG + Intronic
970634511 4:17992802-17992824 CAGTTTTACATTTATGAGTATGG - Intronic
971293482 4:25367945-25367967 CATTTTCACCTAAAAAAGTAGGG + Intronic
972967126 4:44524366-44524388 TAGTTTTCCCTAAAGGAGTAAGG + Intergenic
973312453 4:48724213-48724235 TAGTTTTACATAAAAGACAGGGG + Intronic
974602458 4:64102802-64102824 CAGTTGTAAATAATACAGTAAGG + Intergenic
975056387 4:69936614-69936636 AAGTTTTTCTTGAAAGAGTATGG + Intronic
976202459 4:82593249-82593271 CATTTTTAAATAAAAGAGAGTGG + Intergenic
976647701 4:87402522-87402544 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
976799800 4:88976174-88976196 CAGTTATTCATTAAAGAGAAAGG - Intronic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
978311973 4:107394851-107394873 CATTTGTACATACATGAGTATGG + Intergenic
979499250 4:121419649-121419671 CAGATTTATATAAAAAAATACGG - Intergenic
979814199 4:125079188-125079210 TAGTTTTAGATAAAAGCATATGG - Intergenic
980244185 4:130217286-130217308 TAGTGTTACATAGAACAGTAGGG - Intergenic
980951200 4:139379131-139379153 AAGTTTTACATAACAAAATATGG - Intronic
981206854 4:142052393-142052415 CGGTTTAACACAAAAGAATATGG - Intronic
982455138 4:155600668-155600690 GAGTTCTACATAGAAGAGCAGGG + Intergenic
982869271 4:160555794-160555816 TAGTTGTATGTAAAAGAGTAGGG - Intergenic
982942722 4:161579013-161579035 CAGTTTTACATGAAAAAATGAGG + Intronic
982986176 4:162210076-162210098 CAGCTTTAAATAAAACAGAAAGG - Intergenic
983686090 4:170410783-170410805 AACTTTTATATAAAAGTGTAAGG + Intergenic
983898202 4:173103994-173104016 CAGTTTTAAAAATAAGATTAAGG + Intergenic
984208035 4:176810526-176810548 CAGTTTTAAAGAAAACAATAAGG + Intergenic
987131712 5:14866422-14866444 CAGTATTACTTAAAATATTAAGG - Intronic
987428218 5:17797559-17797581 CATTTGTACAGAAAAGAATAGGG - Intergenic
987581742 5:19803230-19803252 CATTTTTACATATTAGAGTTAGG + Intronic
987725843 5:21698892-21698914 AAGTTTAACTTAAAAGAGCACGG - Intergenic
987803592 5:22731808-22731830 CAGTTTTTCATACAAAACTATGG + Intronic
987876844 5:23690707-23690729 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
988236112 5:28547581-28547603 CGGTTTTACAAAAAAGAAAAAGG + Intergenic
988456837 5:31394301-31394323 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
990438761 5:55822196-55822218 AAGTTTTACATAAAATTGCAGGG + Intergenic
990473561 5:56140493-56140515 CAGTATTACATACAATTGTAGGG + Intronic
991517803 5:67458250-67458272 CAATTTTAAATATCAGAGTATGG + Intergenic
993363748 5:87009664-87009686 CAGTTCAAAATAAAAGTGTAGGG - Intergenic
993748558 5:91634706-91634728 CAGCTTTAAAGAAAAGAGTCTGG + Intergenic
993913719 5:93714977-93714999 CTGTTTTACATAAAAAATTTAGG + Intronic
993983786 5:94573226-94573248 CAGGTTAAGATAAAAGATTATGG + Intronic
994651676 5:102537174-102537196 GAGTTTAACATTAATGAGTATGG - Intergenic
994963226 5:106631443-106631465 TAGTTTCACATAAAAAAGTAGGG + Intergenic
995040551 5:107583475-107583497 CAAGTTCACATTAAAGAGTAGGG - Intronic
995075166 5:107974385-107974407 CAGTTAAACAAAAAAGAGTAAGG + Intronic
996152203 5:120053011-120053033 GGGCTTTACATAAAAGAGTCTGG + Intergenic
996964513 5:129291827-129291849 TATGTTTACATAAAATAGTATGG + Intergenic
999003926 5:147955195-147955217 CAGTTTTACACAACAAAGTCTGG + Intergenic
999214443 5:149920272-149920294 CAGATGTACATAAAAGAGAGTGG + Intronic
1001655926 5:173349708-173349730 CAGTATAACATAAAAGTGCAAGG + Intergenic
1002427167 5:179183221-179183243 CAGTTTTTCTTAAGAGAGAAGGG + Intronic
1006853932 6:37119700-37119722 CAGTTTTAGGTAAAAGTGCAGGG + Intergenic
1007914463 6:45548035-45548057 CAGTTTTGCATAAAAGGAGAAGG - Exonic
1007980454 6:46150606-46150628 CAGTTTTACATAAATTCTTATGG + Intergenic
1008532058 6:52471312-52471334 CAGTTTTACAAATCAGATTAAGG + Intronic
1008845379 6:55957246-55957268 CCGATTTAGATAAAAGAATATGG + Intergenic
1009003989 6:57758929-57758951 CAGTGTTTCATAAATTAGTAGGG - Intergenic
1009194212 6:60665131-60665153 CAATTTTATATAAAAAATTAAGG - Intergenic
1009954190 6:70432595-70432617 GTGTTTTACTTAACAGAGTATGG + Intronic
1010588315 6:77681923-77681945 AAATTTTACATAAAAGAATGAGG - Intergenic
1010686291 6:78858304-78858326 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
1010697375 6:78993246-78993268 CTGTGTAACATAAAAGTGTAGGG + Intronic
1011412482 6:87080373-87080395 CAGTTTTGAATAGAAGAATATGG + Intergenic
1012392651 6:98760502-98760524 CACTATAACATAAAAGAGCAAGG + Intergenic
1012570286 6:100717295-100717317 CAGTAATACATTAAAGACTAAGG + Intronic
1013793802 6:113861442-113861464 CAGTTTTACAAAAATGGGCAGGG - Exonic
1014142662 6:117962506-117962528 CGGTTTTACATCAAAGAAGACGG - Intronic
1014813590 6:125911361-125911383 CTCTTTTACAAAAAAGAGAAGGG - Intronic
1015463943 6:133526408-133526430 CAGTTTTATAGAAAAGTTTATGG + Intronic
1015550497 6:134407185-134407207 CACTTTCATATAAAAGAGGATGG + Intergenic
1016799972 6:148158506-148158528 CAGATTTACACCAAAGAATAAGG + Intergenic
1017273919 6:152543405-152543427 AAGTTTTACATAAAAAATGAGGG - Intronic
1017543023 6:155422518-155422540 CAGTATTACATTTATGAGTAGGG - Intronic
1019007512 6:168812794-168812816 CAGTTTTAAAGTAAAGAGCAAGG - Intergenic
1019099732 6:169619696-169619718 CAGTTTAAGATAAAAGACTGTGG + Intronic
1021287506 7:18798934-18798956 CAGTTTGACATAAGAGCTTAGGG - Intronic
1022454380 7:30545745-30545767 CTCTTTTACAAAAAAGAGAAGGG + Intronic
1023426020 7:40037182-40037204 CAGTTGTACTTAAAAGATTATGG + Intronic
1024909045 7:54423726-54423748 CATTTATACATAAAAAAGTGAGG - Intergenic
1025868536 7:65408017-65408039 CAGTTATACAGTAAATAGTAGGG - Intergenic
1026274765 7:68866972-68866994 CAGGTTAAGATAAAAGATTAGGG - Intergenic
1027597030 7:80186331-80186353 CTGTTTAACATTAAAGAGTGGGG - Intronic
1027876912 7:83782555-83782577 AAGTTTTACAGAAGAAAGTAAGG - Intergenic
1028890612 7:95983992-95984014 GAGTTTTACATAAAACCTTAGGG - Intronic
1030608488 7:111663820-111663842 CAGTTTTCAATAAAATAGAAAGG - Intergenic
1031939145 7:127768883-127768905 CAATTGTACTTAAAAGAGAAAGG - Intronic
1032578304 7:133079127-133079149 CAGGTGTACCTAAAAGGGTATGG - Intronic
1032896842 7:136260967-136260989 CTCTTTTACAAAAAAGAGAAAGG - Intergenic
1035495886 7:159325729-159325751 AAGTTTTGACTAAAAGAGTATGG - Intergenic
1035829684 8:2681298-2681320 TAACTTTACATAAAAGAGTTTGG + Intergenic
1036052276 8:5212946-5212968 CAAGTTAAGATAAAAGAGTATGG + Intergenic
1037239808 8:16764094-16764116 CAGATTTACAAAAAAAAGAAAGG - Intergenic
1038075391 8:24067243-24067265 TTGTTTTACATAATAGAGTATGG + Intergenic
1039331978 8:36547423-36547445 CAGTTTTACCAAAATGACTAGGG - Intergenic
1040933417 8:52758860-52758882 CAGTGTTCAATAGAAGAGTAGGG + Intergenic
1041745754 8:61207606-61207628 CAATTTTACAGAAAAGTCTATGG + Intronic
1045071899 8:98514993-98515015 CAGTTTTATATAGAGGATTAGGG - Intronic
1045613713 8:103879780-103879802 CAGTTTTATATAAAAGTATTTGG + Intronic
1045824542 8:106381454-106381476 CAATTGAACATAAAAGAGAAGGG + Intronic
1046414567 8:113895642-113895664 CTGTTTTACATAAAAGCTTTAGG - Intergenic
1047318145 8:123753437-123753459 CATTTTTACATAAAAGTGATGGG - Intergenic
1048240308 8:132734904-132734926 CATTTTTATATAAAAGGATATGG - Intronic
1050847380 9:10239077-10239099 CTGTTTTACATAAAACACAAAGG + Intronic
1051343226 9:16129960-16129982 GTGTTTTTCATAAAAGAGGAAGG + Intergenic
1051380087 9:16448625-16448647 CAGTATTCCATAAAACAGTGAGG + Intronic
1051391955 9:16574786-16574808 GAGGATTACATGAAAGAGTAGGG - Intronic
1052053366 9:23874955-23874977 CAGTTTTACAGAAGAGAAAACGG - Intergenic
1052161516 9:25266246-25266268 CAGTATTACATACATGAGTGTGG - Intergenic
1052476275 9:28964255-28964277 CAGTATTACAGAACAGAGAAGGG + Intergenic
1055104355 9:72497124-72497146 CAGTTGTGCATAAGAAAGTATGG - Intergenic
1055166276 9:73199182-73199204 CAGTTTAACAAAAAATATTATGG - Intergenic
1055250385 9:74296386-74296408 CAGTTATACATAAATGTTTATGG - Intergenic
1058119584 9:101124017-101124039 CTGTTTTACAAAAAAGAGAAGGG - Intronic
1061975531 9:134066579-134066601 CCATTTTAAAGAAAAGAGTAAGG + Intronic
1186048953 X:5568905-5568927 CAGTTTTAGAAATAAGAATAGGG + Intergenic
1186261566 X:7785570-7785592 CAGATTCAAATAAAAGGGTATGG + Intergenic
1186925491 X:14329132-14329154 AAGTTTTATATACTAGAGTATGG - Intergenic
1187147885 X:16654382-16654404 CTGTTTTACATAAAAAAGGATGG - Intronic
1187982099 X:24768708-24768730 CAGTCTGACACAAAAGAGTGTGG + Intronic
1191642507 X:63442577-63442599 CAGGTTAAGATAAAAGATTATGG - Intergenic
1191877360 X:65810065-65810087 CAGCTTTACAGAAAAGTGGACGG + Intergenic
1192076428 X:68002642-68002664 CAGTTTTAGAAAAAATAGAAAGG + Intergenic
1192582091 X:72292041-72292063 CAATTTTACACAAAAGAAGAGGG - Intronic
1193134461 X:77954673-77954695 CAATTTTAAATAAAAGTGAATGG + Intronic
1194033406 X:88842714-88842736 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
1195600233 X:106738698-106738720 AAGTTTTACATGATAGAGTTGGG - Intronic
1198416463 X:136425183-136425205 TAGTTATACAGAAAAAAGTAAGG + Intergenic
1198724455 X:139662718-139662740 CAGTGTTTCATAGTAGAGTAGGG - Intronic
1198820969 X:140648514-140648536 TACTTTTGCATAAATGAGTATGG + Intergenic
1199223350 X:145342874-145342896 CAGTTTGAAATAAGAGATTATGG + Intergenic
1199376509 X:147117421-147117443 CACTTTTGCACAAAAGGGTAAGG - Intergenic
1200395523 X:155984427-155984449 CGGTTTTACAAAAAAGAAAAGGG - Intergenic
1201601710 Y:15736706-15736728 CATTTTATTATAAAAGAGTATGG + Intergenic