ID: 989215768

View in Genome Browser
Species Human (GRCh38)
Location 5:38902841-38902863
Sequence ATGCATCTGAATACCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989215763_989215768 20 Left 989215763 5:38902798-38902820 CCATCAGAGGACCTCTTTTTAAT 0: 1
1: 0
2: 1
3: 14
4: 189
Right 989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG No data
989215764_989215768 9 Left 989215764 5:38902809-38902831 CCTCTTTTTAATTCTCTCTCAGA 0: 1
1: 0
2: 5
3: 57
4: 433
Right 989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989215768 Original CRISPR ATGCATCTGAATACCCAGGA AGG Intronic
No off target data available for this crispr