ID: 989215909

View in Genome Browser
Species Human (GRCh38)
Location 5:38904404-38904426
Sequence CGCGCCATGTACTCTGTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989215909_989215917 28 Left 989215909 5:38904404-38904426 CCTGCCACAGAGTACATGGCGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 989215917 5:38904455-38904477 TGGAAATGGAGTGAATGGAGTGG 0: 1
1: 0
2: 3
3: 78
4: 1212
989215909_989215916 23 Left 989215909 5:38904404-38904426 CCTGCCACAGAGTACATGGCGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 989215916 5:38904450-38904472 ACTTCTGGAAATGGAGTGAATGG 0: 1
1: 0
2: 1
3: 22
4: 305
989215909_989215912 8 Left 989215909 5:38904404-38904426 CCTGCCACAGAGTACATGGCGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 989215912 5:38904435-38904457 GTGCTGATGCCAGCCACTTCTGG 0: 1
1: 0
2: 1
3: 13
4: 125
989215909_989215913 14 Left 989215909 5:38904404-38904426 CCTGCCACAGAGTACATGGCGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 989215913 5:38904441-38904463 ATGCCAGCCACTTCTGGAAATGG 0: 1
1: 0
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989215909 Original CRISPR CGCGCCATGTACTCTGTGGC AGG (reversed) Exonic
906223689 1:44103671-44103693 CGCGCCATGTCCTGCTTGGCCGG + Intergenic
922705001 1:227786014-227786036 CCCTCCATGTACTGTGTGCCAGG + Intergenic
1070942089 10:80356975-80356997 CGCCCCCTCTACTCTGCGGCGGG - Intronic
1084678314 11:70649755-70649777 CGCTCCATGTAGCCTGGGGCTGG + Intronic
1088529396 11:110792581-110792603 CGCGCCATGCACTCTGGGCTGGG - Intergenic
1096613313 12:52817185-52817207 CCTGCCATGTCCTCTGGGGCAGG - Intergenic
1101008408 12:100425406-100425428 CAAGGCATGTACTGTGTGGCTGG - Intergenic
1127983314 15:64049983-64050005 CGTGCCATGTGGTCTGGGGCAGG + Intronic
1131517158 15:93087284-93087306 GGCTCCACGTTCTCTGTGGCTGG - Intronic
1133184573 16:4086320-4086342 CATGCCATGTACTACGTGGCAGG + Intronic
1139543903 16:67639786-67639808 CGCCCCATCTACTCTGTGCATGG - Intergenic
1141828029 16:86494647-86494669 CGCGCCACTTTCTCTGGGGCTGG - Intergenic
1149963479 17:61137814-61137836 CAGCCCATGTACTCTGTGGACGG + Intronic
1160603901 18:80034490-80034512 CGCGCCATGTGGGCTGCGGCGGG + Exonic
1161011810 19:1963081-1963103 CACGGCATGTCCTCTGTGTCTGG - Intronic
1164824400 19:31273806-31273828 GGCCCCATCTTCTCTGTGGCTGG - Intergenic
1165796664 19:38523789-38523811 CCCGCCATGTATTCTCTAGCTGG - Intronic
925911858 2:8578962-8578984 AGAGACATGTACTCTGGGGCAGG - Intergenic
927702440 2:25276879-25276901 CGCGGCGTGAACACTGTGGCTGG - Intronic
928195821 2:29215824-29215846 CAGGCCATGTAGTCTGGGGCTGG + Intronic
937326703 2:120993730-120993752 CGAGCCATCTCCTCTGTGTCAGG + Intergenic
940205042 2:151193313-151193335 TGGGCCATGGTCTCTGTGGCTGG - Intergenic
940865681 2:158815720-158815742 TGCGCCATGTGCACTGTTGCTGG - Exonic
1176993146 21:15522309-15522331 GGCGCCATGGGCTCTGTGGATGG - Intergenic
1178003493 21:28191563-28191585 TGCTCCATGTGCTCTGTTGCAGG + Intergenic
966742978 3:183251118-183251140 CGGGCCATGTATTCTGAAGCAGG - Intronic
969526251 4:7705617-7705639 GTGGCCATGTGCTCTGTGGCAGG + Intronic
978250064 4:106619879-106619901 CACTCCATGGACTCTTTGGCTGG + Intergenic
984299095 4:177892130-177892152 GGCCCCATGTGCTCTGTAGCGGG - Intronic
984924882 4:184797913-184797935 AGCGCCACATCCTCTGTGGCAGG + Intronic
989215909 5:38904404-38904426 CGCGCCATGTACTCTGTGGCAGG - Exonic
1001308688 5:170595037-170595059 CACACCATTTCCTCTGTGGCAGG + Intronic
1013313032 6:108915340-108915362 CTCGTCATGTTCTCTCTGGCTGG - Intronic
1013512351 6:110856615-110856637 CCTGCCAAGGACTCTGTGGCAGG + Intronic
1029238844 7:99144182-99144204 CCCGCCACGTACGCTGGGGCGGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033795034 7:144836139-144836161 CGCGCCCTGTGCTCTGCGTCCGG + Intronic
1037604019 8:20422418-20422440 CACGCCAGGTAATCTGTGACTGG - Intergenic
1061993804 9:134173986-134174008 CACGCCGTGTACTCTGGGGCTGG + Intergenic
1062218742 9:135403193-135403215 CGAGCCATGTTTTCTGTGCCCGG + Intergenic
1062502829 9:136858605-136858627 TGGGGCATGTACTCTGTGGGTGG - Intronic