ID: 989235812

View in Genome Browser
Species Human (GRCh38)
Location 5:39147427-39147449
Sequence ATATGTACAAAAGTTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2075
Summary {0: 1, 1: 0, 2: 1, 3: 89, 4: 1984}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989235812 Original CRISPR ATATGTACAAAAGTTTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr