ID: 989238896

View in Genome Browser
Species Human (GRCh38)
Location 5:39180760-39180782
Sequence CTGGAGAAGTAGAAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989238896 Original CRISPR CTGGAGAAGTAGAAAGTAGA TGG (reversed) Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902733021 1:18382421-18382443 TTGGGGAAGAAGGAAGTAGACGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
906553461 1:46687203-46687225 CTGGAGAAATATAAAGTAGGGGG + Intronic
906848263 1:49218451-49218473 CTGGAGAAGTAGTCAGAAAATGG + Intronic
907326989 1:53644698-53644720 CTGGAGAGGAGGAAATTAGAAGG + Intronic
908152683 1:61319731-61319753 CTGAAGAAGTAGAATGGATATGG + Intronic
908890815 1:68845261-68845283 CTGGAGGAGTTGAAAGTTGGAGG + Intergenic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
909953768 1:81752374-81752396 TTGGAGGTGTAGAAAGCAGAGGG + Intronic
910009730 1:82446559-82446581 CTTGAGAAATAGAAAGAAGCTGG - Intergenic
911187305 1:94916541-94916563 CTGGAGGAGGAGAGATTAGAGGG - Intronic
911818796 1:102389368-102389390 AAGGAGAAGTAGAAATTAGCAGG + Intergenic
913235940 1:116783571-116783593 TTGGAGAAATAGAAATAAGACGG - Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916006277 1:160664138-160664160 CTGGAGAAGTAGCAATGAGGTGG + Intergenic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
918528056 1:185486584-185486606 CTGGAGAAGTGGAATGGAGCGGG + Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
921852435 1:219945627-219945649 TTGCAGAAGGAGAAAGTACAAGG + Intronic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922343436 1:224676288-224676310 CTGGAGAAGGCAAAACTAGAGGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924113071 1:240719245-240719267 AGAGAGAACTAGAAAGTAGAAGG + Intergenic
924498004 1:244608679-244608701 AGGGAGAAGGAGAAAGCAGAGGG - Intronic
924579420 1:245311067-245311089 CTGAAGAAGGAGAAAGGAAATGG + Intronic
1062764468 10:50138-50160 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1063331073 10:5159980-5160002 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063342683 10:5282873-5282895 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063441069 10:6073642-6073664 TCACAGAAGTAGAAAGTAGAAGG - Intergenic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1064756970 10:18580298-18580320 TCGGAGAAGTGGAAAGTAGTTGG - Intronic
1065120646 10:22526948-22526970 CTTGAAAAGTACAAAGTTGAAGG - Intergenic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065883579 10:30058681-30058703 CTGGAGACGGGGGAAGTAGAGGG + Intronic
1066017338 10:31260929-31260951 CTGGTGTTGTAGAAAGGAGAAGG - Intergenic
1066432377 10:35363548-35363570 CTGGAGATGTGGGAACTAGATGG + Intronic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068275599 10:54792004-54792026 CCTGAGAAGTAGAAAGAACAAGG + Intronic
1068789130 10:61008482-61008504 CTCCAGAAGTAGAATCTAGAGGG + Intergenic
1069020787 10:63486101-63486123 GTGGAGAAGGGGAAAGTAAAGGG + Intergenic
1069902406 10:71713637-71713659 CTCCAGAAGGAGGAAGTAGAGGG + Exonic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070489635 10:76964510-76964532 CTGGAGAAGAAAAAAGTAGTTGG - Intronic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072567569 10:96630182-96630204 CTGAAGAAGTAGAAATAAGGAGG - Intronic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1073798562 10:107015260-107015282 GTGGAGAGATAGAAAATAGATGG + Intronic
1074229696 10:111521711-111521733 CTAGAAAGTTAGAAAGTAGATGG - Intergenic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1075564172 10:123491729-123491751 CAGGAGAAGTAGGATGTAAAAGG + Intergenic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076168722 10:128302826-128302848 CTATAGAGGAAGAAAGTAGAGGG - Intergenic
1076182785 10:128423467-128423489 CAGGAGAAGTATAAAGACGAAGG + Intergenic
1076498585 10:130916205-130916227 CTGGAGCAGAGGAAACTAGAAGG + Intergenic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1080158002 11:29135591-29135613 CATGAGAAGTGGAAAGTAAATGG - Intergenic
1083199557 11:61112038-61112060 CTGGAGCAGTAGAAAGTCATCGG + Intronic
1083201209 11:61122161-61122183 TTGCAAAAGTAGAAGGTAGAAGG - Intronic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086990181 11:93294318-93294340 ATGGAAAAGTTGAAAGTAGTTGG + Intergenic
1087039267 11:93783160-93783182 CTGCTGAAGAAGAAAGTAGATGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087243170 11:95803409-95803431 CTCCAGAAAAAGAAAGTAGAGGG + Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1089712179 11:120323519-120323541 CTGGAGAAGTAAAACATGGAAGG - Intergenic
1089991576 11:122866124-122866146 CTGCAGAAGTAGGTAATAGATGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1092009379 12:5096911-5096933 TTTGAGAGCTAGAAAGTAGAAGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093177167 12:15925675-15925697 CTGAAGAAGTAGAACTTTGAAGG + Intronic
1094164823 12:27432582-27432604 CTGGAGATGTAGAGAGGATATGG - Intergenic
1094400040 12:30052729-30052751 CTGGACAAGTAGTAAGATGATGG + Intergenic
1094814260 12:34167847-34167869 CTGGAGAAGGAGAAAATTGTTGG + Intergenic
1095102664 12:38200743-38200765 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1095298685 12:40557056-40557078 CTTTGAAAGTAGAAAGTAGAAGG + Intronic
1096573699 12:52539848-52539870 CTGGAGAGGGAGAGAGGAGATGG - Intergenic
1096949701 12:55454668-55454690 TTTGATAAGGAGAAAGTAGATGG + Intergenic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1097810088 12:64009710-64009732 CTAGAAAAGGAGAAATTAGAAGG - Intronic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100449151 12:94688702-94688724 GTGGTGGAGTAGTAAGTAGATGG - Intergenic
1100690723 12:97036084-97036106 CTGGTGTAGTAAAAAGAAGATGG - Intergenic
1100774276 12:97957204-97957226 CTGGAGAATGAGAAATCAGATGG + Intergenic
1101134682 12:101730244-101730266 CTGCAGAAGTAAAAATTACAGGG + Intronic
1101242123 12:102848945-102848967 CTGGAGAGGTTGAGAGTAAATGG + Intronic
1102018224 12:109662840-109662862 CTGCAGAAGAATAAAGGAGAAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102319841 12:111923119-111923141 CTGAAGAAGCACAAAGTTGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1105393456 13:20004698-20004720 CTGGATAAGTAGAAAGTAAGAGG - Intronic
1105949178 13:25214074-25214096 CTGGAGCAGGTGACAGTAGATGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107701021 13:43047733-43047755 GTGAAGGAGTAGAAAGTATAAGG + Intronic
1108769653 13:53683908-53683930 TTGGAGAAGTAGAAATGAAATGG + Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109550324 13:63888192-63888214 CTGGATAAATAGAAAATAAATGG + Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1111108139 13:83672898-83672920 CTGGAAAGGAAGCAAGTAGATGG + Intergenic
1111113293 13:83743617-83743639 CTGAAGTGGTAGAAAATAGAAGG + Intergenic
1111713568 13:91848564-91848586 GAGGAGAAAGAGAAAGTAGAAGG + Intronic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112155335 13:96810686-96810708 CTAGTTAAGTAGAAAATAGAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113139736 13:107133902-107133924 CTGGAGAAGAAGCATTTAGAAGG - Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114193881 14:20460846-20460868 CTGGAGAGGAAGCAAATAGAAGG + Intronic
1115588091 14:34835439-34835461 GTGGAAAATTAGAAAGTATATGG - Intronic
1116727344 14:48577005-48577027 CTGGAGAAGTATCGATTAGAGGG - Intergenic
1116983614 14:51196363-51196385 CTGGAGAAGTTGTATCTAGATGG + Intergenic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1121226622 14:92325911-92325933 GTGGAGAAATAGAAAGTTGATGG + Exonic
1121518024 14:94566640-94566662 CTTGAGAAGGAGAGAGGAGATGG - Intronic
1121739729 14:96242994-96243016 CTGGAGAACTAGAACCTGGAGGG + Exonic
1121739771 14:96243234-96243256 CTGGAGAGCTAGAACCTAGAAGG + Exonic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124362912 15:29052157-29052179 CTGAAGAAGTAGAACGTTGCTGG + Intronic
1124468104 15:29958323-29958345 CTGGATAAGTAGCATGTAGCTGG + Intronic
1126039637 15:44577714-44577736 CTGGAAAAGTAAAAAGTAGCAGG + Intronic
1126257948 15:46650297-46650319 TTGGAGCAGAAGAGAGTAGAGGG + Intergenic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127100957 15:55564465-55564487 ATATAGAATTAGAAAGTAGAGGG + Intronic
1127692242 15:61408781-61408803 CTGGAGGAGTATAAAGGAGTTGG - Intergenic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128092915 15:64931191-64931213 CTGGAGGAGAAGGAAATAGAGGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128297025 15:66531049-66531071 GTAGAGAAATAGAAAGTAGTGGG + Intronic
1128336772 15:66791606-66791628 CAGGAGAAGTAAGAAGTACAAGG + Intergenic
1128337293 15:66795306-66795328 CAGGAGAAGTAAGAAGTACAAGG - Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130776370 15:86988171-86988193 CTGGACAAAGAGAAAGTAAATGG + Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137625513 16:49905541-49905563 ATGGAGAGGGATAAAGTAGAGGG - Intergenic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1138761063 16:59544925-59544947 TTGGAGAAGGTGAAATTAGAAGG + Intergenic
1139133355 16:64172629-64172651 CGGGAGAGGGAGAAAGGAGAGGG + Intergenic
1140235065 16:73151599-73151621 CTGGAGGAGTAGAAAGTGTGTGG - Intergenic
1141232171 16:82178722-82178744 CTTGAGCAGTTGAGAGTAGATGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142440183 16:90093107-90093129 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142915713 17:3135191-3135213 CTGGAGAGGTAGAACATAAAGGG + Intergenic
1143737740 17:8925085-8925107 GTGGATAGATAGAAAGTAGATGG + Intronic
1143737758 17:8925409-8925431 ATGGATAGGTAGATAGTAGATGG + Intronic
1143737759 17:8925428-8925450 ATGGAGAGATAGATAGTAGATGG + Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144670042 17:17127730-17127752 CTGTAGCAGTACAGAGTAGAGGG + Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1147282794 17:39376556-39376578 TTGCAGAAGTAGGAAGTTGAAGG + Intronic
1148536390 17:48442581-48442603 CTAGAGAAGTTGGAAGGAGAAGG - Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149912266 17:60577437-60577459 CTGGAGAACTAGACAATATAGGG - Intronic
1150024522 17:61658882-61658904 CTACAGAAGTAAAAAGTAAAAGG - Intergenic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152957368 18:50454-50476 CTGGAGAAGGAGAAAATTGCTGG + Intronic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155578661 18:27278035-27278057 CTAGAGAGGTAGGAAGTTGAGGG - Intergenic
1156300915 18:35835146-35835168 CTGGAAAAATAGTAAGGAGAAGG + Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157502401 18:48200801-48200823 CTGGCGGAGCAGAAAGTAGATGG + Intronic
1158671601 18:59479274-59479296 TTAAACAAGTAGAAAGTAGAGGG - Intronic
1159869790 18:73747421-73747443 CTTAGGTAGTAGAAAGTAGATGG + Intergenic
1161029668 19:2051772-2051794 CAGGGGAAGAAGAAAGTAGGTGG - Intergenic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1163237539 19:16038243-16038265 CTGGGGCAGTTGATAGTAGAGGG - Intergenic
1164554911 19:29244032-29244054 GTTGAGAAGTAAAAAGTAGTGGG - Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164917171 19:32061111-32061133 TTGGAGAAGCAGAAACTAGGAGG - Intergenic
1167141351 19:47652938-47652960 ATGGAAAAGTAAAATGTAGAAGG - Intronic
1167731814 19:51263860-51263882 CTGGAGAAGCAGGAATTATATGG - Intronic
926335437 2:11859231-11859253 CTGGAGAAGTCTATAGTCGAGGG + Intergenic
926781918 2:16480822-16480844 CTGGAGATGTTGAAAGTAGTTGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928096573 2:28408643-28408665 CTGGAAATGGAGAAAGGAGAAGG - Intronic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929913075 2:46109134-46109156 CTGAAGAAGAAGAAAGTTGGGGG - Intronic
930344682 2:50165162-50165184 GTGGAGAAGTATGAAGTAGAAGG + Intronic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932947520 2:76253746-76253768 TTACAGAAATAGAAAGTAGAAGG + Intergenic
933005281 2:76984882-76984904 TTGCACAAGTAGATAGTAGAGGG + Intronic
933596175 2:84285448-84285470 CTAGAGAAGGAGAAACCAGATGG + Intergenic
935257954 2:101329140-101329162 CTGCAGAAGGAGATATTAGAAGG + Intergenic
935410981 2:102761825-102761847 CCACAGAAGTAGAAAGAAGATGG - Intronic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
936414842 2:112297081-112297103 CTTGAGAAATTGAAAGTAGCTGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937960101 2:127451920-127451942 CTGAAGAAGTAAACAATAGAGGG - Intronic
938613020 2:132968885-132968907 CTGAAGAACTAAAAAGAAGAGGG + Intronic
938966680 2:136394778-136394800 CTGGAGGAACAGAAAGTACAGGG + Intergenic
939547530 2:143571654-143571676 CTGGAGAAGTAGAAAGGATGAGG - Intronic
940133704 2:150412578-150412600 CTGGAGTAGTTGAAAGGACATGG - Intergenic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941772240 2:169357635-169357657 CAAGGTAAGTAGAAAGTAGAAGG - Intronic
941780717 2:169441591-169441613 CTGGAGAACTAAAAAGATGAAGG + Intergenic
942018327 2:171840623-171840645 CAGCAGAAATAGAAAATAGAAGG + Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942950660 2:181717445-181717467 GGGGAGAATTAGAAAGAAGAGGG - Intergenic
943582550 2:189702007-189702029 CTGGTGAAGTTCAAAGTACAGGG - Intronic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
944196610 2:197061505-197061527 CAGGAGAAGAAGAAAATAGTGGG + Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
947434998 2:230065841-230065863 CTGGAGAGGGAGAACTTAGAGGG + Intronic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1169730828 20:8784003-8784025 CTGGAGAAGTAGTTAGTATTGGG + Intronic
1169933195 20:10856091-10856113 CTGGACAAGTAGTCAGTGGAAGG + Intergenic
1170182024 20:13542159-13542181 ATGGAAAAGTTGAAAGTAAAAGG + Intronic
1171775454 20:29363223-29363245 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1176926180 21:14752155-14752177 CTGGAGGAGTATAATTTAGAGGG - Intergenic
1178336189 21:31745585-31745607 ATGGAGAAAGAGGAAGTAGAAGG + Intergenic
1178685534 21:34707823-34707845 CTTGAGAACTGCAAAGTAGATGG - Intronic
1178715975 21:34964609-34964631 TTGAAGAAGTACAAAGTTGAGGG + Intronic
1179276244 21:39894251-39894273 CTGGGGAAGCAGGTAGTAGAGGG - Intronic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1180334242 22:11561056-11561078 CTGGAGAAGGAGAAAATCGCTGG - Intergenic
1180735815 22:18016557-18016579 CTGGAAAAGTTGAAACTACAGGG - Intronic
1181299369 22:21868336-21868358 ATGAAGAAGTACAAAGCAGAAGG + Intergenic
1181485576 22:23229739-23229761 ATGGGGAAGTAGAGAGTATAGGG - Intronic
1182431409 22:30301147-30301169 CTGGTGATGTAGAAAGTACACGG - Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951170450 3:19535771-19535793 TTGGAGAGGGGGAAAGTAGAAGG - Intergenic
951963215 3:28352057-28352079 CGGGGGAAGGAGAAAGTACAGGG - Intronic
952147924 3:30553794-30553816 CTGGTGAACTAGAAAGTAAGTGG - Intergenic
952647641 3:35680990-35681012 CTGGAGAAGTAGCATTTAGTTGG + Intronic
952782939 3:37121692-37121714 CTGGGAAAGGAGAAAGTACATGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956864689 3:73357265-73357287 AAGGAGAAGTAGCAAGTAGAAGG - Intergenic
956980578 3:74632536-74632558 GTGAAGAAGTAGAAATGAGAAGG - Intergenic
957421778 3:79980468-79980490 TTGGAGAAGTAGTATGTAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957828734 3:85487465-85487487 CTGAAGAAGAAGAAAGGAAAAGG + Intronic
957905541 3:86549494-86549516 CAGGATATGTAGAAAGTAGTGGG + Intergenic
958196804 3:90251644-90251666 CCGGAGAAATAGGAAGAAGAGGG + Intergenic
958420229 3:93921512-93921534 CGGGAGAAATAGGAAGAAGAGGG + Intronic
958772458 3:98442258-98442280 CTGAAGAAGAACAAAGTTGAAGG - Intergenic
958944050 3:100344897-100344919 CAGGAGAGGTGGAAAGTAGGTGG - Intronic
959249609 3:103925240-103925262 CTGGAGAAGTAGATAGTTATGGG - Intergenic
959360758 3:105388263-105388285 CTGGAGAAGGAAGAAGTAAAAGG + Intronic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
960352429 3:116609740-116609762 GTGGAGAAGTAGAAGATAGGTGG - Intronic
960529921 3:118753013-118753035 GAGGAGAAGGAGAAAGGAGAAGG + Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
963347524 3:144113064-144113086 GTGGAGAAGTAGAAAAAAGTGGG - Intergenic
963719738 3:148848846-148848868 GCAGAGCAGTAGAAAGTAGATGG + Intronic
964074805 3:152680761-152680783 CTGGAGAATAAGAAGATAGAAGG + Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
966236101 3:177703499-177703521 GTGGAAAAGAAGAAAGGAGAAGG + Intergenic
967037008 3:185655508-185655530 CTGGGGAAGTAGAAGGTTGCTGG + Intronic
967320862 3:188193721-188193743 GTTGAGAAATAGCAAGTAGAAGG + Intronic
967332819 3:188308960-188308982 GAGGAGAAGGAGAAAGGAGAAGG - Intronic
969100278 4:4763299-4763321 ATGGGCAAATAGAAAGTAGAGGG - Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
972379494 4:38505898-38505920 CTGGAATATTAGAATGTAGAGGG - Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
973658860 4:53081401-53081423 GTGGACTAGTAGAAAGTGGAGGG - Intronic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974740486 4:65999675-65999697 CTGCAGAAGCAGAAAATAAAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975380556 4:73695905-73695927 TTGGAGTAATAGAGAGTAGAAGG + Intergenic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
975683912 4:76901060-76901082 CTGGAAAGGGAAAAAGTAGATGG + Intergenic
976860399 4:89658778-89658800 CTGGAGGAGGAGGAAGTAGGCGG + Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977139507 4:93350543-93350565 CTTGAGAAGTAGATAGTACAAGG + Intronic
977417492 4:96751613-96751635 CAGGCGAAGTAGTGAGTAGAGGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
980978703 4:139635554-139635576 CTGGTGAGATAGAAAGTATAAGG - Intergenic
981619339 4:146676369-146676391 GAAGAGAAGAAGAAAGTAGAAGG - Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
983970588 4:173867179-173867201 ATGGAAAAGTAAAAAATAGATGG + Intergenic
984521254 4:180803852-180803874 TTGGAAATGTACAAAGTAGAAGG - Intergenic
984635714 4:182107021-182107043 CTAGACAAGTACAAACTAGATGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986560690 5:9058014-9058036 GTGGGGAAGTAGAAAGTTGCAGG + Intronic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989500648 5:42163058-42163080 TTGGATAAGTAAACAGTAGAGGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990428858 5:55714775-55714797 CTGGAGAAGGAGATAGTTGGGGG + Intronic
991215831 5:64156602-64156624 CTGGGGAAATAGTAAGGAGAAGG + Intergenic
992371388 5:76147577-76147599 CTGGGGAATTTGAGAGTAGAGGG + Intronic
994815964 5:104589065-104589087 CATGAGGAGTAGTAAGTAGATGG + Intergenic
994832182 5:104798784-104798806 CGGGAGAAGTAGCACGGAGACGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
998445281 5:142193756-142193778 CTGAAGAAGTACTAAGTACAGGG - Intergenic
998698091 5:144664032-144664054 CTTGAGTAGTACAAAGCAGAGGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999389717 5:151181161-151181183 CTGGAGAAGGAGCAAGTTGTGGG - Exonic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1001025705 5:168222716-168222738 GTGGAGAAGGAGAGAGTATAGGG - Intronic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001397941 5:171429889-171429911 CTGGAAAAGTAGAAAGGAGGTGG + Intronic
1002530982 5:179845074-179845096 ATGGAAAAGTAGAAAATATAAGG - Intronic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1003772127 6:9317088-9317110 CTAGAGAATTGGAAAGTAGCTGG + Intergenic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1005214084 6:23504632-23504654 CTGGAGAAGAAGTAAGTGTACGG - Intergenic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006805104 6:36783005-36783027 GTGGAGAAGGCGAAAGGAGATGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1008739263 6:54585434-54585456 ATGGAGAAGTAATAAGTATAAGG - Intergenic
1009509976 6:64538873-64538895 CTGGTGGAGTAGAAAGAACATGG - Intronic
1009551240 6:65095216-65095238 CTGCAGAAGTAAACAGTAAAAGG + Intronic
1009628205 6:66163514-66163536 CTGGGGAAGGAGAAAGGAAAGGG + Intergenic
1009887699 6:69643671-69643693 CCTGAGAAATACAAAGTAGATGG + Intergenic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1010185311 6:73137321-73137343 CCAGAAAAGTAGAAAGTAGCAGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012600985 6:101096591-101096613 CTGGAGAAATATAAAATAGTAGG + Intergenic
1013008222 6:106094963-106094985 CTCGAGAAGAACAAAGTAGAAGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013822354 6:114170054-114170076 ATGGAGAAGGTTAAAGTAGAAGG + Intronic
1014010803 6:116473593-116473615 TTGGAGAGCTAGAAAGTAGATGG + Intergenic
1014159519 6:118151952-118151974 CAGAGGAAGTAGAAAATAGAGGG - Intronic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015452967 6:133391800-133391822 GGGAAGGAGTAGAAAGTAGAGGG - Intronic
1015648667 6:135427509-135427531 TTGAAGAGGTAGAAAGTAGAAGG - Intronic
1015931360 6:138363345-138363367 ATGGTGAACTAGAAAGCAGATGG + Intergenic
1015968879 6:138723420-138723442 CTGAGGAAGTTGAAAGTAGATGG - Intergenic
1016486338 6:144543647-144543669 GAGAAGAGGTAGAAAGTAGAAGG - Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016820107 6:148339155-148339177 ATTGATAAGTAGAAAGTAGCTGG + Intronic
1017630263 6:156390011-156390033 ATGTAAAGGTAGAAAGTAGAAGG + Intergenic
1017638434 6:156466348-156466370 CAGGAGAAGTTAAAAGCAGAGGG - Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019496772 7:1344420-1344442 CGGGAGCAGGAGAAAGGAGAGGG + Intergenic
1019810073 7:3158775-3158797 CTGGAGAAAAAGGAAGTCGATGG + Intronic
1020950085 7:14664515-14664537 CTGGAGAGGGAGAAAATACAAGG - Intronic
1022339921 7:29458515-29458537 CTTGAGAAGTAAAAAGTTGGGGG - Intronic
1022438281 7:30410870-30410892 TTGGATAGATAGAAAGTAGATGG + Intronic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1023745471 7:43318921-43318943 CTGGTGAAGTGGAAACTACAAGG + Intronic
1024420698 7:49162459-49162481 CTGGAGAAGGATAAATGAGAAGG - Intergenic
1024553228 7:50581136-50581158 CTGGTGAGATAGAAAGTATAAGG - Intergenic
1025151031 7:56549675-56549697 CTGGACAAGCAGAAAATAAAGGG - Intergenic
1025737850 7:64168833-64168855 CTGGACAAGCAGAAAATACAGGG + Intronic
1025766156 7:64453206-64453228 CTGGACAAGCAGAAAATAAAGGG + Intergenic
1026849701 7:73717181-73717203 GGGGAGAAGGAGAAAGAAGAGGG + Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1028744536 7:94312385-94312407 ATGGTGAAGTAGAAAATAGAAGG - Intergenic
1028807395 7:95044275-95044297 GTAGAGGAGGAGAAAGTAGAGGG - Intronic
1028982833 7:96985600-96985622 ATGCAGAAGTAGAAACTAAAAGG + Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1030769774 7:113459819-113459841 ATGGAGAAGTAGGAAGTAGTGGG - Intergenic
1033150432 7:138910087-138910109 GAGGGGAAGTAGATAGTAGATGG + Intronic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1036071598 8:5446552-5446574 CTGAAGAAGAACAAAGTTGAAGG + Intergenic
1036816059 8:11903616-11903638 CTGGCTGAGTAAAAAGTAGATGG - Intergenic
1037932767 8:22892092-22892114 CCAGGGAAGGAGAAAGTAGAGGG + Intronic
1038191922 8:25330175-25330197 CTGGAGAATATGGAAGTAGATGG + Intronic
1039008568 8:33068393-33068415 ATGGAGAAATAGAAATTAGTAGG + Intergenic
1039139272 8:34367207-34367229 CTGTATAAGTAGGAAGTAAACGG - Intergenic
1039142201 8:34402711-34402733 CTGCAGTAGTAGAAACTGGAAGG - Intergenic
1039163438 8:34648816-34648838 CTGGAGGAGAAGAAAATTGAGGG - Intergenic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1039778812 8:40763303-40763325 CTGGAAAAGTAGAAAACAAAAGG - Intronic
1041864305 8:62551829-62551851 CAGGATAAGTAAAATGTAGATGG - Intronic
1042428975 8:68681979-68682001 ATGAAGAGATAGAAAGTAGAAGG + Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1045838706 8:106554135-106554157 CTGGAGAATTTGAAAATAGATGG + Intronic
1045892927 8:107179155-107179177 CTGGAGAAGATGAAATTTGATGG + Intergenic
1046783882 8:118245144-118245166 CTGGTGAAGCAGAAAATAAATGG - Intronic
1047818290 8:128489351-128489373 GTGAAAAAGTAAAAAGTAGAAGG + Intergenic
1048518903 8:135136069-135136091 TAGGAGAACAAGAAAGTAGAGGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048820565 8:138376562-138376584 CTGGAGAAGTAAGAAGTTGATGG - Intronic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1050131778 9:2420459-2420481 CTGAAGAAGTAGAAAGGACGTGG - Intergenic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1053402942 9:37843930-37843952 CTAGAAAAGTTGAAAGTAAAAGG + Intronic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1057008577 9:91582269-91582291 CTGTAGGAGTAGAAAGTATGTGG - Intronic
1057200380 9:93136695-93136717 CAGGAGAACTTGAAAGTAGGTGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057779137 9:98035563-98035585 TTGGGGAAGCAGAAAGTAGGTGG + Intergenic
1057931361 9:99196291-99196313 GTGGAGAAGAAGAGAGCAGAAGG - Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058858980 9:109095886-109095908 CTGGAGAAAAAGAGACTAGAGGG + Intronic
1059047019 9:110879812-110879834 CTGGAGAAGTATTTAGGAGACGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060233415 9:121842130-121842152 CTGGGGATGTAGAAAGTCAATGG + Intronic
1060843420 9:126813848-126813870 CTAGAAATGTAAAAAGTAGAGGG - Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1062740778 9:138174119-138174141 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203608542 Un_KI270748v1:76009-76031 GTGGAGAGGGAGAAAGGAGAGGG + Intergenic
1186311238 X:8322084-8322106 TTCTAGAAGTAGAAAGTAGATGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189557879 X:42164209-42164231 CTGGTGAGGCAGAAAGTATAAGG + Intergenic
1189907598 X:45777570-45777592 GTGGAGAAGTAGCAAGTAGGAGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1194383933 X:93229882-93229904 CTGGAGTAGAAGAAGGTAGCTGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194897400 X:99461267-99461289 CTGGAGAAATATAAAGTTAAAGG + Intergenic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196049773 X:111292658-111292680 GTGGAGACAAAGAAAGTAGATGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196979537 X:121196239-121196261 TTGGGGAAGTATAAATTAGAAGG - Intergenic
1198066831 X:133106542-133106564 CTGGAGAAATAGAAACAATAGGG - Intergenic
1198539291 X:137619678-137619700 CTAGAGACATAGAAAGTGGATGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199222371 X:145332355-145332377 TTATAGAAGTAGAGAGTAGAAGG - Intergenic
1201069260 Y:10129498-10129520 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201759311 Y:17519902-17519924 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1201842243 Y:18386088-18386110 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1202039169 Y:20664815-20664837 CTGGAGAAGTAAAGAGAATAAGG - Intergenic