ID: 989239021

View in Genome Browser
Species Human (GRCh38)
Location 5:39182230-39182252
Sequence CAGTGTGAACAGAGTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989239018_989239021 -10 Left 989239018 5:39182217-39182239 CCTCAAATAATGCCAGTGTGAAC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG No data
989239017_989239021 12 Left 989239017 5:39182195-39182217 CCTCATTCATCTTCTTATCATTC 0: 1
1: 0
2: 5
3: 45
4: 482
Right 989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG No data
989239016_989239021 23 Left 989239016 5:39182184-39182206 CCTCACTGCAACCTCATTCATCT 0: 1
1: 0
2: 2
3: 38
4: 441
Right 989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989239021 Original CRISPR CAGTGTGAACAGAGTGCAGG TGG Intronic
No off target data available for this crispr