ID: 989240864

View in Genome Browser
Species Human (GRCh38)
Location 5:39201990-39202012
Sequence CCTTCTAAGCTGACAGTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989240864_989240874 -6 Left 989240864 5:39201990-39202012 CCCCCCACTGTCAGCTTAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 989240874 5:39202007-39202029 AGAAGGGGCCTTAGGGAACCTGG 0: 1
1: 0
2: 0
3: 17
4: 213
989240864_989240876 1 Left 989240864 5:39201990-39202012 CCCCCCACTGTCAGCTTAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 989240876 5:39202014-39202036 GCCTTAGGGAACCTGGCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 214
989240864_989240879 12 Left 989240864 5:39201990-39202012 CCCCCCACTGTCAGCTTAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 989240879 5:39202025-39202047 CCTGGCAGGAGGAGTCCCTGAGG 0: 1
1: 0
2: 2
3: 67
4: 715
989240864_989240875 -2 Left 989240864 5:39201990-39202012 CCCCCCACTGTCAGCTTAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 989240875 5:39202011-39202033 GGGGCCTTAGGGAACCTGGCAGG 0: 1
1: 1
2: 1
3: 30
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989240864 Original CRISPR CCTTCTAAGCTGACAGTGGG GGG (reversed) Exonic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
901327031 1:8373038-8373060 TCTGCTCAGCTGACAGTGGTAGG - Intronic
902235367 1:15053889-15053911 CCCTGGAAGCTGGCAGTGGGAGG + Intronic
903219377 1:21860323-21860345 CCTCCTCACCTGACATTGGGTGG - Intronic
905294061 1:36942934-36942956 CCTTGTAATCTGAAGGTGGGGGG - Intronic
905471171 1:38193201-38193223 GCTTCTAAGCTGACATTTGAAGG + Intergenic
906133100 1:43473613-43473635 CCTTCTCAGCTGACAGAGTAAGG - Intergenic
906151173 1:43588544-43588566 ACTTCTAGGCTGGAAGTGGGTGG + Intronic
906922440 1:50078891-50078913 CCTTCTGAGCTCACAATGGAAGG - Intronic
909979616 1:82083034-82083056 TCTTCAAAACTGACAGTGGCTGG - Intergenic
910464651 1:87485316-87485338 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
914359425 1:146920028-146920050 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
914494324 1:148179847-148179869 CCTTCTGAGGTGACAGAGGGAGG + Intergenic
914684004 1:149961970-149961992 CCTTCTACTCTGTCAGTGTGCGG - Intronic
914704505 1:150159865-150159887 GCTTCTAAGCTTAGAGCGGGAGG + Exonic
917475344 1:175364729-175364751 TCTTCTAAGCTGGTAGTGGGAGG + Intronic
918286471 1:183060117-183060139 ATTTCTAAGCAGACAGTGAGTGG - Intronic
920840289 1:209548194-209548216 GCTCCTAAACTGACAGTTGGTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065450286 10:25849385-25849407 CCTGGTAAGATGACAGTGTGTGG + Intergenic
1066087176 10:31982432-31982454 TCTTCTAATATGACAGAGGGAGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1072737904 10:97891576-97891598 CCCTCCAGGCTGGCAGTGGGCGG - Intronic
1074454495 10:113585682-113585704 CCTTCTGAGCTAAGAGTTGGTGG + Intronic
1074907372 10:117876983-117877005 TCTCCTAAGCAAACAGTGGGTGG - Intergenic
1075933300 10:126318002-126318024 CCTTCTCAGCTGACAGAGTGTGG - Intronic
1077008628 11:370349-370371 CCTGCTAAGCGGGCAGGGGGTGG - Intronic
1079105092 11:17566048-17566070 CCTTCTCAGCTGACAGAGAAAGG + Intronic
1080751965 11:35158947-35158969 CCTTCTGTCCTGGCAGTGGGTGG + Intronic
1081872845 11:46391262-46391284 CCTGCTGAGCCGCCAGTGGGAGG + Intergenic
1085678521 11:78548725-78548747 CCTTCTGACATGACAGTGTGGGG + Intronic
1091306441 11:134539227-134539249 CCTTGCAATCTGACAGTGAGAGG + Intergenic
1091669470 12:2442534-2442556 CCTGCTCCTCTGACAGTGGGTGG - Intronic
1091849318 12:3682482-3682504 CCATCTTTGCTGACAATGGGAGG - Intronic
1093340584 12:17968169-17968191 CCTTCTAAGCTGACAGAGCAAGG + Intergenic
1094690555 12:32764287-32764309 CATTCAAAGCTGCCCGTGGGTGG + Intergenic
1096857811 12:54497722-54497744 CCATCTAAGCTGAAAGTGTTTGG + Exonic
1096894156 12:54803261-54803283 CCTTCTCACCTAACACTGGGGGG - Intergenic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1101914370 12:108884907-108884929 CCTTCTAAGCCTTCAGTGGATGG + Intronic
1102109576 12:110354761-110354783 CCTTCTGAGCTGACAGTACAAGG - Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1106851285 13:33795549-33795571 CCTTCCAAGCTTACAGTGGTGGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1110439396 13:75510338-75510360 CCTTAAAAGCTGACAGAGTGGGG - Intergenic
1110651777 13:77950475-77950497 CCTTCAGAGCTGACAGAAGGAGG + Intergenic
1114473197 14:22977809-22977831 CCTCCTGAGCTAACAGTGGCAGG + Intronic
1116171747 14:41411285-41411307 CCTTCTAAGTTAACGCTGGGTGG - Intergenic
1117496958 14:56314953-56314975 CATTCTAAGCTAACTATGGGAGG + Intergenic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125957351 15:43799655-43799677 CCTACTAAGTTGTCAGTGGGCGG - Exonic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1128469282 15:67938417-67938439 CCTTCTCAGCTGACAGCAAGAGG - Intergenic
1129263683 15:74382749-74382771 CCTTCTAACCTGAGCGAGGGAGG + Intergenic
1130519638 15:84652569-84652591 CCTTCTAGTCTAACAGAGGGAGG - Intronic
1132772247 16:1570252-1570274 CCCTCTCAGCTGACAGAGTGAGG + Intronic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1137874388 16:51981822-51981844 CCCTCTGAGCTGACAGAGAGAGG - Intergenic
1138291030 16:55846932-55846954 GCTTGTAAGTTTACAGTGGGAGG - Intronic
1138914212 16:61443079-61443101 CCCTCTCAGCTGACAGAGGAGGG - Intergenic
1141423584 16:83931971-83931993 CATTCTCAGCTGGCTGTGGGTGG + Intronic
1143670326 17:8392243-8392265 CCTTCTAAGCTGGCAGGTTGGGG + Exonic
1148236279 17:45971372-45971394 ACTTCTAAGTGGACATTGGGTGG - Intronic
1155156163 18:23159282-23159304 TCTTCTAGGCTGGGAGTGGGAGG + Intronic
1160857701 19:1224737-1224759 CCTGCTAAGCCCACTGTGGGTGG + Intronic
1163816495 19:19468221-19468243 TCCTCAAAGCTGACAGTGGCTGG - Intronic
1166292282 19:41870797-41870819 CCTTCTCACATGGCAGTGGGCGG + Intronic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1168199657 19:54805457-54805479 CCTTCAAAGCCCACAGTGGCTGG - Intronic
925567115 2:5268417-5268439 CCTTCTAACTTGCCAGTGAGTGG + Intergenic
926841468 2:17085415-17085437 TCTTCTTAGGTGAAAGTGGGTGG - Intergenic
931689495 2:64823202-64823224 CCTCCTAAAATGAAAGTGGGAGG - Intergenic
933967231 2:87440039-87440061 CCTTCTGAGCATGCAGTGGGAGG + Intergenic
934066252 2:88344810-88344832 TCTTCCAAGCTGGCAGTGGCAGG - Intergenic
934944205 2:98525238-98525260 TCTTCAAAGCTGGCAGTGGCAGG + Intronic
934969761 2:98753761-98753783 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
936326564 2:111510456-111510478 CCTTCTGAGCATGCAGTGGGAGG - Intergenic
937534385 2:122867746-122867768 CCTTCTATGTTGTCTGTGGGTGG + Intergenic
942040178 2:172053332-172053354 CCTTCTGAGCTTACTGTAGGAGG + Intronic
942695269 2:178635439-178635461 CCTGCAAAGCTGACACTTGGAGG - Exonic
942996952 2:182274170-182274192 CCTTCCAAGGTGACGGTAGGAGG - Intronic
945510632 2:210698042-210698064 CCTTCTCAGCTGACAGAGCAAGG + Intergenic
946305922 2:218857065-218857087 TCTTCTAAGGTGATAGTGGTGGG + Intergenic
946541612 2:220690098-220690120 CCTGCTAATCTGACAGGAGGAGG + Intergenic
947026006 2:225738595-225738617 CCTTCTCAGTTGTCACTGGGTGG - Intergenic
947116354 2:226775584-226775606 CCTTCTCAGCTGACAGAGCATGG - Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
948945389 2:241216666-241216688 CCTGGTAAGGTGACAGTGGTAGG - Intronic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1174456324 20:50651220-50651242 CCTTCCTAGCTGTCACTGGGGGG - Intronic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1181815905 22:25436632-25436654 CCTTCTAGGCTGCCGGGGGGAGG + Intergenic
1181815917 22:25436691-25436713 CCTTCTAGGCTGCCGGGGGGAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184538208 22:45101878-45101900 CCTTCTAGGCTGACAGCGGTGGG - Intergenic
1185064646 22:48625209-48625231 CCTTCTTGGCCGACAGAGGGAGG + Intronic
950593051 3:13952814-13952836 CCTTCATAGCTGACAGAAGGAGG + Intronic
950858910 3:16130307-16130329 CCTTCTAGGCTGTTAGTTGGTGG + Intergenic
953602976 3:44386563-44386585 GCTTCTGAGCTGACAGGGGTGGG - Intronic
954287482 3:49629355-49629377 GCTTCTATTCTGACAGTTGGGGG + Intronic
954676707 3:52319888-52319910 CCATGCAAGCTGGCAGTGGGGGG - Intronic
959694467 3:109234486-109234508 CCTGCTGAGTTCACAGTGGGAGG + Intergenic
960170362 3:114454057-114454079 TCTTCTAACCAGACAGCGGGAGG - Intronic
960334841 3:116404018-116404040 AATTCTAAGCTGACTTTGGGAGG - Intronic
961690733 3:128667618-128667640 CCTTCATAGCTGACAGAAGGAGG - Intronic
969222150 4:5767924-5767946 AATTCTAAGCTGCCGGTGGGGGG - Intronic
970280417 4:14449016-14449038 CCTTCTGGTCTGAGAGTGGGAGG - Intergenic
972370072 4:38414975-38414997 CTTCCTGGGCTGACAGTGGGTGG - Intergenic
974697367 4:65393499-65393521 CCTTCTTAGCTGACTGTGGCTGG + Intronic
975407949 4:74013591-74013613 CATTGTAAGCTGACACTGGAAGG - Intergenic
976470337 4:85421016-85421038 CAAAGTAAGCTGACAGTGGGCGG + Intergenic
979423759 4:120538820-120538842 CCTTCTGAGCTGACAGCGCAAGG + Intergenic
985097073 4:186423434-186423456 CCTTCCATGCTAAGAGTGGGTGG - Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
994636007 5:102344914-102344936 CCTTCAAAGCTGACAGAAGGAGG + Intergenic
995245628 5:109932108-109932130 CTTTGTAAGCTCAAAGTGGGAGG - Intergenic
998437009 5:142119033-142119055 CCTTCTAAGCTGACAGAGCAAGG + Intronic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
1003983720 6:11415269-11415291 GCTTCCAAGCCAACAGTGGGGGG - Intergenic
1008834443 6:55808503-55808525 CCTGCTGAGCTCACAGAGGGAGG - Intronic
1011675344 6:89727859-89727881 CCTTCAAAGCTGCCAGTAAGGGG + Exonic
1012684423 6:102226384-102226406 GATGCCAAGCTGACAGTGGGTGG - Intergenic
1014136808 6:117898765-117898787 CCTCCTAACCTGACAGGAGGCGG - Intergenic
1019916274 7:4134732-4134754 CCCGGTAAGCTGACAGTGAGTGG - Intronic
1026459351 7:70599789-70599811 CCTTCTAAGTTGTCTGTGGTGGG + Intronic
1028650964 7:93150484-93150506 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
1029573471 7:101387036-101387058 CCTGCTTTGCTGACAGCGGGTGG + Intronic
1031880730 7:127195607-127195629 CCTTCTAAGTTGACAGGAGAGGG - Intronic
1033584115 7:142761587-142761609 CCTCCTCAGCGAACAGTGGGTGG + Intronic
1034650104 7:152683502-152683524 CCTTCTGAGCTCACCGTGGGCGG + Intergenic
1037603642 8:20419706-20419728 CCTTCTATGCACACAGTGTGTGG - Intergenic
1038155401 8:24984623-24984645 CTTTTTAAGCCAACAGTGGGAGG + Intergenic
1038639770 8:29314381-29314403 ACTTCTAATATCACAGTGGGTGG + Intergenic
1041474936 8:58253868-58253890 CCTTCTGAGCCGACAGAGGTAGG - Intergenic
1041476473 8:58272664-58272686 AGATCTAAGCTGATAGTGGGAGG + Intergenic
1046979808 8:120324742-120324764 TCTTCGAAGCTGACAATGGTAGG - Intronic
1048715332 8:137262308-137262330 CCTGATAACCTGACGGTGGGGGG + Intergenic
1049280065 8:141739787-141739809 CCTTCCAGGCTGCCTGTGGGTGG + Intergenic
1055816445 9:80212663-80212685 ACTTCTAAGCTCACAGAGGCAGG - Intergenic
1056203878 9:84301786-84301808 CCCTCTGACCTGTCAGTGGGAGG - Intronic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1186055066 X:5641591-5641613 CCTTCTAAGCTGAAGGCAGGAGG - Intergenic
1187170870 X:16850551-16850573 CCTTTAAAGCAGACAGTTGGGGG - Intronic
1189183860 X:39033912-39033934 TCTTCTAAACTAGCAGTGGGAGG - Intergenic
1189699409 X:43701630-43701652 CTTTCTGTGCTGCCAGTGGGAGG - Intronic
1190359135 X:49633026-49633048 CCTTCTCACCTAACACTGGGGGG - Intergenic
1193386645 X:80880714-80880736 CCTTCTTAGCTGTAAGGGGGAGG - Intergenic
1199745815 X:150771410-150771432 CCTTCCCAGCTGACAGGTGGGGG + Intronic