ID: 989243284

View in Genome Browser
Species Human (GRCh38)
Location 5:39224344-39224366
Sequence CTGTGAAAACAGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 481}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989243276_989243284 1 Left 989243276 5:39224320-39224342 CCCTTACTACAGGGATTAAGCGT 0: 1
1: 0
2: 0
3: 2
4: 27
Right 989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG 0: 1
1: 0
2: 4
3: 42
4: 481
989243272_989243284 25 Left 989243272 5:39224296-39224318 CCTTTAGCACAGTCCTGACGGTT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG 0: 1
1: 0
2: 4
3: 42
4: 481
989243277_989243284 0 Left 989243277 5:39224321-39224343 CCTTACTACAGGGATTAAGCGTC 0: 1
1: 0
2: 0
3: 5
4: 22
Right 989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG 0: 1
1: 0
2: 4
3: 42
4: 481
989243273_989243284 12 Left 989243273 5:39224309-39224331 CCTGACGGTTTCCCTTACTACAG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG 0: 1
1: 0
2: 4
3: 42
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989243284 Original CRISPR CTGTGAAAACAGATGGGGGA GGG Intronic
900014736 1:140149-140171 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900044603 1:495351-495373 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900045002 1:498758-498780 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066006 1:730257-730279 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066405 1:733666-733688 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066801 1:737072-737094 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900067199 1:740488-740510 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
901636462 1:10672500-10672522 CTTTGAAAACAGATTGGGCCCGG - Intronic
901713735 1:11136378-11136400 CTGTGAAGACAGATGTCTGAGGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903606328 1:24577657-24577679 CTGAGAAAAAAAATTGGGGATGG - Intronic
904817759 1:33218764-33218786 CTGAGAAACCAGATGGGTTAAGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
909392271 1:75131719-75131741 CCCTAAAAACAGATGGGGGCAGG - Intronic
910689014 1:89947303-89947325 ACCTGACAACAGATGGGGGAAGG - Intergenic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912579088 1:110704298-110704320 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
913018615 1:114764404-114764426 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
915234405 1:154469974-154469996 CTGTGTAAACAGTTCAGGGATGG + Intronic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
915363082 1:155297576-155297598 CACTGAAAATAGATGGGGGGTGG - Intronic
915405932 1:155659783-155659805 TTGTGAAAACAGAGGAGGGAAGG - Exonic
915419097 1:155765576-155765598 TTGTGAAAACAGAGGAGGGGAGG - Exonic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917050391 1:170915925-170915947 CTGTTAAACCAGATGGGTAATGG - Intergenic
918752416 1:188289674-188289696 CTGTGAAAGCAGCTGGGAGGAGG - Intergenic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924344055 1:243057723-243057745 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065687400 10:28300278-28300300 CTCTGAAAACCATTGGGGGAGGG + Intronic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066098760 10:32098284-32098306 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1068104999 10:52603700-52603722 ATGTGTAAATAGATGGGGAATGG + Intergenic
1068178778 10:53495264-53495286 CTGAGAAAAGCAATGGGGGAAGG - Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1069210291 10:65749579-65749601 TTGAGAAGACAGCTGGGGGAGGG + Intergenic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070838074 10:79463897-79463919 CTGTGAGAACAAATGAGGTAAGG - Intergenic
1071035423 10:81238842-81238864 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071738280 10:88326798-88326820 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1072808254 10:98439341-98439363 CTGTGAAAACAGCTGGGAAGAGG + Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074123793 10:110512483-110512505 CTCTGAACACAGTTGGGGAAAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1076970934 11:131826-131848 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1076971330 11:135249-135271 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1080855660 11:36109372-36109394 CAGTGGGAACATATGGGGGATGG + Intronic
1081816340 11:45945554-45945576 CTCAGAAAACAGATGGGGTGGGG - Intronic
1082686663 11:56246219-56246241 CTGTGAAAACTGAGAGGGTAGGG - Intergenic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084600832 11:70144578-70144600 CTGTGAAAATCAATGTGGGAAGG + Intronic
1084862097 11:72025747-72025769 CTGTGTAATCACATGGGGTATGG - Intronic
1085054616 11:73396261-73396283 CATTAAAAACAGCTGGGGGAGGG - Exonic
1086334022 11:85781871-85781893 CTGTGAAAGCAGTTGGGAGGGGG - Intronic
1086669331 11:89527974-89527996 CTGTGAAAGCATCTGGGAGAGGG + Intergenic
1087908562 11:103726971-103726993 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1088395264 11:109361227-109361249 CTAAGAAAACACATGGGGGGAGG - Intergenic
1089166512 11:116481617-116481639 CTATGAAAGCAGATGGCGTAAGG - Intergenic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1091521471 12:1248386-1248408 CTGTGATAGATGATGGGGGAGGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092582081 12:9852753-9852775 CTGTCAAAACAAAGGGGGGTGGG - Intergenic
1092675707 12:10916571-10916593 CTATGAAAAGAGTTGGTGGAAGG + Intronic
1093083952 12:14845733-14845755 CAGTGAAAACAACTGGGGTAGGG + Intronic
1093151992 12:15632856-15632878 CTGTGGAAACCGGTGTGGGAAGG + Intronic
1093246201 12:16740177-16740199 CTGTTAAAAAAGATGAGGTAAGG + Intergenic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095092063 12:38116968-38116990 CCATGAAAACTGATGGGGCACGG - Intergenic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1097194059 12:57234164-57234186 CAGTGAGATCAGCTGGGGGAGGG - Intronic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097445687 12:59668300-59668322 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100508387 12:95243464-95243486 CCAAGAAAAAAGATGGGGGAGGG - Intronic
1100854968 12:98750349-98750371 CTGTGAGACCAGATGCTGGAGGG + Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102011587 12:109622386-109622408 ATCTGAAAAGAGGTGGGGGAGGG - Intergenic
1102030560 12:109737881-109737903 CTCAGAACAGAGATGGGGGAGGG + Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103197547 12:119058031-119058053 CTGGGAAAGAAGATGGGGAAGGG + Intronic
1103264638 12:119618480-119618502 CTGTGAAAGCAGCTAGGGAAGGG + Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103748822 12:123144853-123144875 CTGTTAAAAGAGATCGGGCATGG - Intronic
1103994654 12:124821312-124821334 CTGAGAAACCAGGTGGGAGAGGG - Intronic
1104239198 12:126971098-126971120 GTGTGAAAACAGAGGGGCAATGG + Intergenic
1104752199 12:131246815-131246837 CTGTGAGCACAGAAGTGGGAAGG - Intergenic
1104787181 12:131457236-131457258 CTGAGAAGTCAGATGGGGGCTGG - Intergenic
1104833973 12:131775096-131775118 GTGTTAAAACAGAGGGGAGATGG - Intronic
1105757359 13:23480221-23480243 CTCTTAAAACAGATAGGAGAAGG + Intergenic
1106434258 13:29709791-29709813 CTGTTATAACAAATGTGGGAAGG + Intergenic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1107612212 13:42126747-42126769 TTATGACAAGAGATGGGGGAAGG - Intronic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108498670 13:51048898-51048920 CTGAGTTAACAAATGGGGGAAGG + Intergenic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1108785983 13:53901901-53901923 TTGTGAAAATATTTGGGGGAAGG - Intergenic
1109749636 13:66672638-66672660 CTGTGAAAGCAGTTGGGAGGGGG + Intronic
1110328709 13:74246862-74246884 GTGTTAAAAAAGATGAGGGAGGG + Intergenic
1111263683 13:85778145-85778167 CTGTAAAAACAGTTGAGTGAGGG + Intergenic
1111764234 13:92507209-92507231 CTGTGAAGACAAACGGTGGATGG - Intronic
1112525293 13:100140810-100140832 CTTAGAAAACAAATGTGGGAAGG + Intronic
1113281158 13:108789403-108789425 CTCTGAAAAATGAAGGGGGAGGG - Intronic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119891837 14:78188577-78188599 CTCTGCCTACAGATGGGGGAAGG + Intergenic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121179755 14:91919988-91920010 CTCTGAAACCAGACAGGGGAGGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1122892909 14:104741312-104741334 CCGTGGGAACCGATGGGGGAGGG + Intronic
1122977486 14:105176876-105176898 GTCTGAATACAGATGTGGGAGGG - Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1125539498 15:40461845-40461867 CTCTGAAAGCAGATGGGTGATGG + Intronic
1125617297 15:41026260-41026282 CTGTGAAAACAGGCTGGGCACGG + Intronic
1125788188 15:42341332-42341354 CTGTGAGATCACTTGGGGGAAGG + Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127613707 15:60662156-60662178 ATATGACAACAGTTGGGGGATGG + Intronic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1130665373 15:85864862-85864884 CTTTGAAAGCAGGTGTGGGAGGG - Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1130843464 15:87723313-87723335 CTGTGACAACAGGTGAGGGTTGG - Intergenic
1130913596 15:88287981-88288003 CCCTGGAAACTGATGGGGGAAGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131883679 15:96886274-96886296 CTGTGAATACAAATGGGGAGTGG - Intergenic
1132252700 15:100346147-100346169 CAGTGAAAAGGGATAGGGGAGGG - Intergenic
1132272431 15:100538178-100538200 CTGTGAAAACAGCTGGGAGCAGG - Intronic
1132811259 16:1798947-1798969 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133121774 16:3612737-3612759 CAGTGAGAACAGATGAGGCAAGG + Intronic
1133319280 16:4903011-4903033 CTCAGGAAACTGATGGGGGAAGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134611096 16:15608519-15608541 CTTTGAAAACACACGGGGGGAGG + Intronic
1135874633 16:26186818-26186840 CTGTGAAACCTGATGAGGGCAGG + Intergenic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1137489312 16:48918418-48918440 CTGTGAAAACAGAGTTGGGAGGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138009060 16:53361094-53361116 CTTTGAAAACAAATGAGGGCCGG - Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1140659298 16:77172199-77172221 ATGAGAAAACAGGTTGGGGAAGG - Intergenic
1140796711 16:78445227-78445249 TTGTGGAAATAGATGGGGTATGG - Intronic
1141306044 16:82865138-82865160 CTGTGAAAGCAGCTGGGAGTGGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141802800 16:86322637-86322659 CTGAGAAAATAGTTGCGGGATGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142448923 16:90162273-90162295 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1142449324 16:90165692-90165714 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1142457772 17:66189-66211 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1142458172 17:69609-69631 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1145118783 17:20236837-20236859 CTGTGAAAATAGAAACGGGAGGG - Intronic
1146124365 17:30220242-30220264 CTCTGACAACAGATTTGGGAGGG - Intronic
1147442751 17:40457473-40457495 CTGTGACCACAAATGGGGTAGGG - Exonic
1147834359 17:43319496-43319518 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1148001450 17:44389887-44389909 CTGTACAGCCAGATGGGGGAAGG - Intergenic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1149029555 17:52067651-52067673 CTGTGAAAGCAGCTGGGAGGTGG + Intronic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1150642342 17:66958093-66958115 GTTTGAAAACAGGTGCGGGAGGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153577229 18:6534648-6534670 CTCTGAAAACTCATGGGAGAGGG - Intronic
1155200833 18:23516183-23516205 CTGTGAGAGGACATGGGGGACGG + Intronic
1155247063 18:23920537-23920559 GTCAGAAAACAGATGGTGGAAGG + Intronic
1155294476 18:24372498-24372520 TTGTGAATACACATGTGGGAGGG - Intronic
1155975958 18:32132163-32132185 TTTTGAAAAAAGATGGGGAAGGG + Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158025525 18:52892385-52892407 CTGAGAAGAAAGATGGGGAAAGG - Intronic
1158791456 18:60784855-60784877 CTGTGAAAACAGCTAGGAGGGGG + Intergenic
1158986682 18:62824885-62824907 CTGTTAAAAAAAATGGGGGGTGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1160647885 19:202115-202137 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1160648283 19:205529-205551 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1161241650 19:3226410-3226432 TTTTGAAAAGAGATGGGGAATGG - Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1161634196 19:5377060-5377082 CTGTGAGAACATGTGGAGGAAGG + Intergenic
1162052958 19:8046230-8046252 CTCAGAAAACAGATGTGGAAAGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1165283821 19:34820547-34820569 GTGTGAAAAAAGATGGCCGAGGG + Intergenic
1165365427 19:35362230-35362252 CTGAGAAAACAGATGTGGAGAGG + Intergenic
1165932046 19:39365644-39365666 GTGAGAAAACAGATTTGGGAAGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1168132136 19:54328302-54328324 GTGTGAAAACAGGTAGGGGGAGG + Intergenic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926526831 2:13991847-13991869 CTATGAAAGCAGCTGGGGGTCGG - Intergenic
927306612 2:21580825-21580847 TTCAGAAAACAGATAGGGGAAGG + Intergenic
927341855 2:21992079-21992101 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
929042763 2:37761443-37761465 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
930427796 2:51233925-51233947 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
933508069 2:83204004-83204026 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
936378952 2:111967491-111967513 CCTTGGAAACAGATGGGTGAAGG - Intronic
936478527 2:112863673-112863695 ATAAGAAAACAGATGGTGGATGG - Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940485795 2:154294086-154294108 CTGTGAGCACAGATGGCTGATGG + Intronic
940596127 2:155795470-155795492 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
942279651 2:174347264-174347286 CTTTGAAAACAGAGGAGGGGGGG + Intergenic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943238951 2:185360206-185360228 CTGTCAAAAAAAAGGGGGGAGGG + Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
943609424 2:190015000-190015022 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
947746007 2:232507696-232507718 ATGTGCACACACATGGGGGAAGG + Intergenic
947832442 2:233151103-233151125 TTGTGGAAACAGATCAGGGATGG + Intronic
947983135 2:234426719-234426741 GAGTGTCAACAGATGGGGGAGGG + Intergenic
1171131389 20:22656854-22656876 CTGTGAAGAGAGGTGGGGAAGGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1171858278 20:30370415-30370437 CTGTGAAGACAACTGGGGTAAGG + Intergenic
1171952666 20:31435160-31435182 CACTGAATAGAGATGGGGGAAGG - Intergenic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1177522139 21:22239448-22239470 CTGTGAAAACAGCTGGCAGGGGG + Intergenic
1178106095 21:29320912-29320934 CTGAGCAAACAGATGGGAGCAGG - Intronic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1179384081 21:40925529-40925551 CTGTGAACACAGGTGAGGGGTGG - Intergenic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182032742 22:27172706-27172728 TTGTTATAAAAGATGGGGGAAGG - Intergenic
1182368305 22:29793279-29793301 CTGTGTAAACAAGTGGGTGAGGG + Intronic
1182780891 22:32866664-32866686 CTGTGATAAAAGGTGGGGAAGGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1203294947 22_KI270736v1_random:32932-32954 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
949184878 3:1178601-1178623 ATGAGAAAACAGTGGGGGGAAGG - Intronic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950411047 3:12837575-12837597 CTGTTAGAAAAGATGGGCGAAGG - Intronic
950628470 3:14265760-14265782 GTGTGAAAACAAATATGGGAAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952207032 3:31190570-31190592 CTTTGAAAACAGATAGGCAAGGG + Intergenic
952504476 3:33995582-33995604 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
958870946 3:99558322-99558344 CTGGGACAGTAGATGGGGGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959809052 3:110593994-110594016 CTGTGAAAACAGCTGGGAGTAGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
962613121 3:137097757-137097779 CTGGGAAAACAGTCAGGGGAAGG + Intergenic
962851932 3:139314399-139314421 CTGGGAAGAAAAATGGGGGAAGG + Intronic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
963954217 3:151235272-151235294 CTTTGTAAACTGATGGGGGCAGG + Intronic
965395847 3:168159679-168159701 CTGTGAAAACACACGGGGTCAGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
967603872 3:191420957-191420979 CAAAGAAAACAGATCGGGGAAGG + Intergenic
968369563 3:198214586-198214608 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
968369962 3:198218000-198218022 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971962579 4:33507888-33507910 CTATGAAAGCAGATGGGAGGGGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972250382 4:37293652-37293674 TTATGAAACCAGATGGTGGATGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
974269563 4:59633165-59633187 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
974317893 4:60306199-60306221 CTGTGAAAACAGCCGGGAGGGGG - Intergenic
974677515 4:65112576-65112598 ATGTAAAAACAGATGGCTGATGG + Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976952517 4:90850425-90850447 CTGTGAAACCAGCTGGGAGCTGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977211249 4:94220542-94220564 CTTTGAAAACTGATGAGGGCTGG - Intronic
978044936 4:104114367-104114389 CCATGAAAACAGGTGGGAGAGGG - Intergenic
978515605 4:109565482-109565504 CAGTGAAAACATTTGGGTGAAGG + Intronic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
980163420 4:129195246-129195268 CTGTGAAAACTACTTGGGGATGG - Intergenic
980742693 4:136973142-136973164 CAGTGAAAACAGCTGGGAGGGGG - Intergenic
982204899 4:152990222-152990244 CTGTGAATACTGATGGGTGATGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983766402 4:171489724-171489746 GTGTGAAAACAGCTGGGTGGGGG + Intergenic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
985723994 5:1506181-1506203 CTGTGAAAACTGCTTGGAGAGGG + Intronic
986019539 5:3788474-3788496 CAGTGAAAAGAGATAGGGGTGGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
986798155 5:11232349-11232371 CTGTGAAAGCAGCTGGGAGTGGG + Intronic
986837783 5:11660218-11660240 CCATGAAAAAGGATGGGGGAAGG + Intronic
987216531 5:15743534-15743556 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
994228372 5:97282082-97282104 CTGTGATAACATATGGGTGCAGG + Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
995392356 5:111653173-111653195 CCGTGAAAGCAGCTGGGGGGAGG - Intergenic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997525589 5:134551050-134551072 TTATGCAAACAGCTGGGGGACGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998416741 5:141951710-141951732 TTGTGTGATCAGATGGGGGATGG + Intronic
998980602 5:147698025-147698047 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000051243 5:157564618-157564640 AGGAGAAAGCAGATGGGGGAAGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002728842 5:181320171-181320193 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1002729241 5:181323578-181323600 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1003563676 6:7204334-7204356 CTATGCAAACAAATGGGGGATGG - Intronic
1005499557 6:26418050-26418072 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1006030667 6:31174557-31174579 CTGTGAAGAGAAATGGGGGTAGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006432514 6:34006488-34006510 CTCTGCAAACAAATGGGGGTGGG + Intergenic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG + Intronic
1007945846 6:45826283-45826305 CTTGGATAACAGATGGGAGATGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008003071 6:46381151-46381173 TTCTGAAATGAGATGGGGGAGGG - Intronic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1010835879 6:80586900-80586922 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1011169411 6:84489372-84489394 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1013405619 6:109840089-109840111 GGGTGAAAAGACATGGGGGAAGG + Intergenic
1013420126 6:109959919-109959941 GGGTGAAAAGACATGGGGGAAGG - Intergenic
1013910744 6:115272944-115272966 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1014143563 6:117971350-117971372 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1021593995 7:22295145-22295167 CTATGAAAAAAGAAGTGGGATGG + Intronic
1022010549 7:26304704-26304726 CTGTGAACACAAATGGGGATGGG + Intronic
1022419227 7:30205008-30205030 CTGTGAAAACATAAAGGGGCCGG - Intergenic
1022430053 7:30309998-30310020 CTGTGACAACAGTTTGGGGAAGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022740071 7:33112243-33112265 CTGGGAGAACATATGGGGGCAGG - Intergenic
1023634437 7:42195475-42195497 CTGTAAAAACAGATGTGAGGAGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024073569 7:45807016-45807038 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1025053846 7:55748514-55748536 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1025131953 7:56378987-56379009 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1025789576 7:64676685-64676707 CTGTGGACACATATGGGGGGAGG - Intronic
1027343887 7:77237873-77237895 CTGAGACAAGAGGTGGGGGAAGG - Intronic
1028858961 7:95625692-95625714 CTGCTAAAACAAATAGGGGAAGG + Intergenic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030580312 7:111346956-111346978 CTGTGATAATAGATGGCAGAGGG + Intronic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032050966 7:128650714-128650736 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1034752776 7:153586512-153586534 CAATGAAAACACATGGGGGCAGG - Intergenic
1034908101 7:154968806-154968828 CTGTGAAAACTGATGCGGATGGG + Exonic
1036610652 8:10347046-10347068 CTGTGAAAACACATTGGAGGGGG - Intronic
1036657031 8:10683375-10683397 CTGAGAAATCAGATGTGGGAAGG - Intronic
1036981533 8:13474584-13474606 CCGTGAAAGCAGCTGGGAGAGGG + Intronic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1039107364 8:34003997-34004019 CTGTGAAAGCAACTGGGGTAAGG - Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041984782 8:63909129-63909151 CTGTGAAAGCAGCTGGGAGGTGG - Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042407491 8:68422541-68422563 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
1042755156 8:72202482-72202504 CTGTGAGAGCAGATGGGTGGGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044628059 8:94253925-94253947 TTGTGAAAATAGAGTGGGGATGG - Intronic
1044707007 8:95018581-95018603 CTGAGAAGACAGGTGGGGGTGGG + Intronic
1044732435 8:95240044-95240066 GTCTGAAAGCAGATGGGAGAGGG + Intergenic
1044823380 8:96174071-96174093 CTGTGAAGAAAGAAGGGGGTAGG - Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1047880482 8:129187068-129187090 ATGTGATAACAGATAGGGCAAGG - Intergenic
1049011526 8:139890592-139890614 CTGAGAAAACAGACCGGGAAGGG - Intronic
1049285905 8:141775074-141775096 CCGTGTGAACAGATGGGGAAGGG + Intergenic
1050266663 9:3897859-3897881 CTCTGGAATCAGATGGGGGTGGG + Intronic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1052008909 9:23383092-23383114 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1052383449 9:27796948-27796970 ACGTGAATAGAGATGGGGGAAGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1052846355 9:33339955-33339977 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1055194555 9:73572791-73572813 GTGTGAAAACTGAAGTGGGAAGG + Intergenic
1055679921 9:78704429-78704451 CTGTGAAAGCAGTTGGGAGGGGG + Intergenic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056516429 9:87355449-87355471 CTTTCAAAACATATGGGTGAAGG - Intergenic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1057598772 9:96439098-96439120 CTGTTAATAATGATGGGGGAGGG + Intergenic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058439166 9:104991560-104991582 GCGTGACAACAGATGGGGGGAGG + Intergenic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059109716 9:111544153-111544175 CTAGGAAAATAGATGGGGGCTGG + Exonic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1060547122 9:124468265-124468287 ATGTGAAAATAGTTGGGGGCAGG - Intronic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062753902 9:138277270-138277292 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203576421 Un_KI270745v1:12049-12071 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203576818 Un_KI270745v1:15458-15480 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203577220 Un_KI270745v1:18880-18902 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187549704 X:20289889-20289911 TTGTGACAAAAGATGGGGAATGG + Intergenic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187707088 X:22019678-22019700 ATGTGAAAAGAGAAAGGGGATGG + Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1189071253 X:37866373-37866395 CTGTGAAAGCAGCCGGGGGTTGG - Intronic
1190083369 X:47374247-47374269 CTGTGACAACAGATGAGTGAGGG - Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190441372 X:50478088-50478110 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191971084 X:66817029-66817051 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1195206990 X:102611102-102611124 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1197581950 X:128294572-128294594 CCGTGAAAGCAGCTGGGAGAAGG + Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198274726 X:135089794-135089816 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic
1199170892 X:144733374-144733396 CCGTGAAAACAGCTGGGAGGGGG - Intergenic
1199185428 X:144910380-144910402 CTGTGAAAGCAGTTGGGAGGGGG - Intergenic
1199532614 X:148867376-148867398 CTGGTAAAAGAGATGAGGGAAGG + Intronic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1199908331 X:152259009-152259031 CAGTGACAGCAGATTGGGGAGGG - Intronic
1199909700 X:152272210-152272232 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1200584114 Y:4986432-4986454 GTATGACATCAGATGGGGGAGGG - Intergenic