ID: 989247490

View in Genome Browser
Species Human (GRCh38)
Location 5:39270221-39270243
Sequence TTATGAGCAGTTTGGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989247490_989247497 27 Left 989247490 5:39270221-39270243 CCTGGGATCCAAACTGCTCATAA 0: 1
1: 0
2: 1
3: 13
4: 108
Right 989247497 5:39270271-39270293 TGGCACCAAGCTATCCTATGAGG No data
989247490_989247493 1 Left 989247490 5:39270221-39270243 CCTGGGATCCAAACTGCTCATAA 0: 1
1: 0
2: 1
3: 13
4: 108
Right 989247493 5:39270245-39270267 AGGAAACTCGACTAAATTACTGG 0: 1
1: 0
2: 0
3: 3
4: 75
989247490_989247496 7 Left 989247490 5:39270221-39270243 CCTGGGATCCAAACTGCTCATAA 0: 1
1: 0
2: 1
3: 13
4: 108
Right 989247496 5:39270251-39270273 CTCGACTAAATTACTGGGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 45
989247490_989247494 2 Left 989247490 5:39270221-39270243 CCTGGGATCCAAACTGCTCATAA 0: 1
1: 0
2: 1
3: 13
4: 108
Right 989247494 5:39270246-39270268 GGAAACTCGACTAAATTACTGGG No data
989247490_989247495 3 Left 989247490 5:39270221-39270243 CCTGGGATCCAAACTGCTCATAA 0: 1
1: 0
2: 1
3: 13
4: 108
Right 989247495 5:39270247-39270269 GAAACTCGACTAAATTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989247490 Original CRISPR TTATGAGCAGTTTGGATCCC AGG (reversed) Intronic
901912373 1:12470218-12470240 TTATGAGGAGTATGGGTCACAGG + Intronic
904462724 1:30689763-30689785 TGCTGAGCTGTCTGGATCCCGGG - Intergenic
907765659 1:57408250-57408272 TTATGAACACATTAGATCCCAGG - Intronic
909425366 1:75518163-75518185 TTATGAGCAGTTTAAATTCGAGG + Intronic
909711490 1:78655047-78655069 TTATGAACCATATGGATCCCTGG + Exonic
912391969 1:109309173-109309195 TTTTGAGCAGGTTTGACCCCTGG - Intergenic
917284945 1:173413828-173413850 TTATTATCAGTTAGGATTCCTGG - Intergenic
923717549 1:236437870-236437892 TTCTGAGCAGCTGGGATCACAGG + Intronic
923930391 1:238688282-238688304 TTATGAGCAATTAGGGGCCCTGG + Intergenic
1064099047 10:12447576-12447598 TTTTGAGTAGTTGGGACCCCAGG - Intronic
1064212735 10:13374231-13374253 TCCTGAGCAGTTAGGATCCCAGG - Intergenic
1070853618 10:79587189-79587211 TCATGAGAAGTATGTATCCCTGG + Intergenic
1071750135 10:88466102-88466124 CTATGAGCAGATGGGATGCCAGG + Intronic
1076354362 10:129841312-129841334 TTATCAACAGCTTGGATTCCTGG + Intronic
1078147863 11:8734287-8734309 TAATGAGCATTTTGCATCCATGG - Intronic
1083827785 11:65212912-65212934 TTATGAGAGGTTAGGGTCCCAGG - Intergenic
1084400701 11:68941298-68941320 TTATCAGCTGTTTGGATTCTGGG - Intergenic
1094638545 12:32250376-32250398 TAATGAGCAGTATGTATCCCAGG - Intronic
1095075413 12:37915745-37915767 CTTTGAGCAGTTTGGATACACGG - Intergenic
1099797193 12:87413896-87413918 TCATCAGCACTTTGGATTCCAGG - Intergenic
1100265124 12:92968542-92968564 TTATGAGCAGTTTAAGTCTCAGG - Intergenic
1101871711 12:108571256-108571278 TGATGTGCAGTTTGAATCCCTGG - Intergenic
1108898324 13:55363892-55363914 TTACTATTAGTTTGGATCCCTGG - Intergenic
1110494861 13:76155991-76156013 TCATGAGCAGGCTGGAACCCAGG + Intergenic
1111701923 13:91700847-91700869 TTATGAGCTGTTTGTCTCCTGGG + Intronic
1119658156 14:76432133-76432155 TTCTCAGCAGTTTTGCTCCCAGG + Intronic
1121630811 14:95420647-95420669 TTAAGAGCATTTTGGAATCCAGG - Intronic
1123434529 15:20245363-20245385 TTATCAGCAGTTTGCGTTCCTGG - Intergenic
1125357805 15:38834563-38834585 TTATGTGTAGTTTTGTTCCCTGG + Intergenic
1128784494 15:70385023-70385045 TTCTGAGCAGTTTGGATTTGGGG - Intergenic
1129874374 15:78963423-78963445 TCCTGAGTAGTTGGGATCCCAGG + Intronic
1133672201 16:8033643-8033665 TTCTGAGCAGTTGGGATTACAGG - Intergenic
1134861507 16:17564539-17564561 TTCTGAGCAGTTGGGACCACAGG - Intergenic
1136850092 16:33605740-33605762 TTATCAGCAGTTTGCATTCCTGG + Intergenic
1140557378 16:75937123-75937145 TCCTGAGCAGTTGGGATCACAGG - Intergenic
1140600819 16:76472915-76472937 TTATGAGCAGGTTTGTTACCAGG - Intronic
1141001906 16:80316328-80316350 CTATGAGCAGTTTGGAGGCAAGG + Intergenic
1203111705 16_KI270728v1_random:1454193-1454215 TTATCAGCAGTTTGCATTCCTGG + Intergenic
1143295172 17:5865793-5865815 TTTGGAGCAGTTTGGATTTCAGG - Intronic
1146770828 17:35567585-35567607 TTCTGAGCAGCTTGGATTACAGG - Intergenic
1148356422 17:46978728-46978750 TGATGAGCAGGTTGCAGCCCAGG + Exonic
1152458463 17:80429332-80429354 GTGTGGGCAGTTTGGATTCCAGG + Intronic
1153282971 18:3431321-3431343 TCATGAACAGTTGGGATCACCGG - Intronic
1153908602 18:9686470-9686492 TCCTGAGTAGTTTGGATCACAGG + Intergenic
1157013260 18:43678276-43678298 TTATGATCATTTTGGATTTCTGG + Intergenic
1157515934 18:48311421-48311443 TTATGGGCAATTTGCCTCCCAGG + Intronic
1158255103 18:55537464-55537486 TTTTGAGTAGTTGGGATCACAGG - Intronic
1165030754 19:32996486-32996508 TTATCAGCAGTTTGCATTCCTGG - Intronic
1167951359 19:53030300-53030322 TTTTGAGCAGCTGGGATCACAGG - Intergenic
1168613843 19:57821955-57821977 TTCCGAGCAGTTGGGATTCCAGG + Intronic
929771682 2:44897662-44897684 TAATGTGCAGGTTGGTTCCCAGG + Intergenic
931634825 2:64331735-64331757 TTATGAGCACTCTTGATGCCTGG + Intergenic
934560151 2:95309010-95309032 TTCTGAGCAGTTGGGTTCCTTGG - Intronic
940080987 2:149800977-149800999 TTTTGAACAGTTTGGACCCTGGG + Intergenic
940913766 2:159231801-159231823 TTAAAAGCAGTTTGGAAACCAGG - Exonic
944373422 2:199012021-199012043 ATATGGGCAGTCTGGAGCCCAGG + Intergenic
944696980 2:202210668-202210690 CTTTGAGCAGTTTGGTTCACTGG - Intronic
945764774 2:213961816-213961838 TTATCAGCAGTTTTGATCTATGG + Intronic
1168743577 20:216207-216229 TTGTGTGGAGTTTGGAGCCCAGG + Intergenic
1172040827 20:32044281-32044303 TCCTGAGCAGTTGGGATCACAGG - Intergenic
1175668430 20:60880132-60880154 TTATGATGAGTTGGGTTCCCTGG - Intergenic
1179792672 21:43764530-43764552 TCATGGGCAGTTAGGCTCCCGGG + Intergenic
1180304540 22:11064335-11064357 TTCTGAGCAGTTGGGATTACAGG - Intergenic
1181951471 22:26556958-26556980 TTGTGAGCAGCTGGGATCACAGG - Intronic
1185250714 22:49800204-49800226 TTCTGAGCAGTTTGGAGTCCGGG - Intronic
952124947 3:30289835-30289857 TTATGCTCAGTTTGCTTCCCTGG + Intergenic
953942046 3:47108475-47108497 TTAGGTGGAGTTTGAATCCCAGG - Intronic
964527140 3:157626975-157626997 TTCAGAGCAGTGTGGAACCCTGG + Intronic
967662648 3:192132025-192132047 TTCTGAGTAGTTTGGATTACAGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
972302373 4:37797067-37797089 TTATGAGCCCATTGCATCCCAGG - Intergenic
975851433 4:78576895-78576917 TTATGTGTAGTTTGTATGCCTGG - Intronic
980483743 4:133425678-133425700 GTCTGAGCAGTTTGCATCCTGGG - Intergenic
981258141 4:142687816-142687838 TGATGAAAAGTTTGGATCCCGGG - Intronic
982467499 4:155748654-155748676 TTATCAGCATTTTCAATCCCAGG + Intergenic
982547394 4:156751350-156751372 TCATGACCTGTTTTGATCCCAGG + Intergenic
984640526 4:182159632-182159654 TTCTTAGCAGCATGGATCCCTGG + Intronic
985871931 5:2564073-2564095 TCCTTAGCAGTGTGGATCCCGGG + Intergenic
989247490 5:39270221-39270243 TTATGAGCAGTTTGGATCCCAGG - Intronic
990314073 5:54567685-54567707 TGATGAGCAGTTTGGTTACAAGG + Intergenic
995452941 5:112322607-112322629 TCAAGAGCAGTTTGGCTCACCGG - Intronic
996553844 5:124757804-124757826 TCACCAGCAGCTTGGATCCCAGG - Intergenic
997448969 5:133966480-133966502 ACATAAGCAGTTTGGATCACTGG - Intronic
998097558 5:139405015-139405037 CTATGGGCAGTTTGGTTCCAGGG + Intergenic
999959454 5:156738452-156738474 TTATGATCAGTTTTGACCTCTGG + Intronic
1000302201 5:159966301-159966323 TTATGAGCACTCTGGATCCCAGG - Intronic
1001114452 5:168927588-168927610 CTAAGAGCAGATTGGATCCCAGG - Intronic
1005139379 6:22610200-22610222 TAATGAGCAGTGTGGACACCAGG - Intergenic
1005690578 6:28300965-28300987 TTTTGAGCAGGCTGGATCTCAGG - Exonic
1006196045 6:32243241-32243263 TCATAAACATTTTGGATCCCTGG - Intergenic
1011058726 6:83237067-83237089 TTCTGAGCAGTTGGGACCACAGG - Intronic
1011079487 6:83473749-83473771 TTATGAGCATTTTGGCTCACAGG + Intergenic
1012098681 6:95000140-95000162 TTATGAGCATTTACAATCCCTGG - Intergenic
1012666162 6:101973006-101973028 TTATGATCACTTTGGCTCTCTGG + Intronic
1014102860 6:117530754-117530776 TTATCATCAGTTTGGACTCCTGG - Intronic
1016797592 6:148134342-148134364 TTAGGAGCAGTTTGGCTCGTAGG - Intergenic
1017141638 6:151196303-151196325 TTCTGAGCAGTTGGGATCACAGG - Intergenic
1017589196 6:155960178-155960200 TTATAGGGAGTTTGTATCCCAGG - Intergenic
1019205927 6:170361915-170361937 TTCTGAGTAGTTGGGATTCCAGG + Intronic
1022102706 7:27178097-27178119 TTACTAGCAGTTTCGATCTCAGG - Intronic
1023471104 7:40521122-40521144 TCATGTTCAGTTTGAATCCCCGG + Intronic
1025639583 7:63354009-63354031 TTGTGAGCGGTGCGGATCCCTGG - Intergenic
1025643116 7:63394083-63394105 TTGTGAGCGGTGCGGATCCCTGG + Intergenic
1026589370 7:71682048-71682070 TTATGAGTAGTTGGGATTACAGG + Intronic
1027120263 7:75513330-75513352 TTATGAGCAGCTGGGATTACAGG - Intergenic
1030009387 7:105151261-105151283 TTAAGAGCAGTCTGAATCCAAGG - Intronic
1030393224 7:108953047-108953069 TTATGAGCAGTTGTCAACCCAGG + Intergenic
1031239534 7:119219845-119219867 CTATGAGCAGTTTGGAGCCTGGG + Intergenic
1031345819 7:120665059-120665081 TAATCAGCATTTTGGGTCCCTGG - Intronic
1035678267 8:1470036-1470058 TCATGAGCAGCTGGGATCGCAGG - Intergenic
1045615920 8:103910912-103910934 TTATTAATAGTTTGAATCCCAGG + Intronic
1047135809 8:122076949-122076971 TTATGAGCATTTTGGACACAAGG + Intergenic
1048130875 8:131695460-131695482 TTAGGAGGTGTTTGGGTCCCGGG - Intergenic
1049123708 8:140766127-140766149 TTTTCAGCAGTTTGGATAACAGG - Intronic
1051059957 9:13034407-13034429 AGCTGAGCAGTGTGGATCCCTGG + Intergenic
1051572230 9:18572069-18572091 TTCTGAGCAGTTGGGATTACAGG - Intronic
1055479611 9:76696735-76696757 TTTTGACCAGTGAGGATCCCTGG + Intronic
1057147323 9:92767026-92767048 TCATTAGCAGTATGGATCCATGG + Intergenic
1058033527 9:100225347-100225369 TTATTCAAAGTTTGGATCCCAGG - Intronic
1058653592 9:107199641-107199663 TTATGAGCACTTTCTGTCCCAGG + Intergenic
1062102270 9:134734471-134734493 TTATGTGCAGCTTGGACCCAAGG - Intronic
1187278919 X:17841660-17841682 TTATGAGCACTGTGGGTCCCGGG + Intronic
1189490916 X:41471233-41471255 TTCTGAGCAGTTGGGATTACAGG + Intronic