ID: 989251297

View in Genome Browser
Species Human (GRCh38)
Location 5:39319047-39319069
Sequence CTGTGCTATGGGAGGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989251297_989251308 27 Left 989251297 5:39319047-39319069 CCCCCAACCCTCCCATAGCACAG 0: 1
1: 0
2: 5
3: 20
4: 317
Right 989251308 5:39319097-39319119 ACACACAAAACATAGGCCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 152
989251297_989251307 20 Left 989251297 5:39319047-39319069 CCCCCAACCCTCCCATAGCACAG 0: 1
1: 0
2: 5
3: 20
4: 317
Right 989251307 5:39319090-39319112 CACACATACACACAAAACATAGG 0: 1
1: 2
2: 53
3: 434
4: 2359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989251297 Original CRISPR CTGTGCTATGGGAGGGTTGG GGG (reversed) Intronic
900395477 1:2451603-2451625 CTGCGCCATGGGTGGGCTGGGGG + Intronic
900521683 1:3108616-3108638 CTCTGCTTTTGGAGGGGTGGAGG + Intronic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
901122525 1:6907260-6907282 CTGGGCTCTGGGATGGATGGAGG + Intronic
901743218 1:11355807-11355829 CTTTGCGATGGGAGGGTGAGAGG + Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902846554 1:19115158-19115180 CTGTCCTGTGGCAGGGGTGGAGG - Intronic
903013102 1:20344074-20344096 CTGGGCTATGCGTGTGTTGGTGG - Intronic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
904598291 1:31660323-31660345 CTGTGCCATGCCAGGCTTGGGGG - Intronic
904830092 1:33300743-33300765 CTGTGCGAGGGCAGGGCTGGGGG + Intergenic
905380003 1:37555155-37555177 CTGTGCTTTGGGAGAGATGATGG - Intergenic
906609650 1:47192542-47192564 CTATGCTTTGGGAGTGGTGGGGG + Intergenic
907270485 1:53288164-53288186 GTGTGCTTGGGGAGGGTTTGTGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907470654 1:54671444-54671466 CTGCCCTATGGGAGGGATGTGGG + Intronic
908542979 1:65139145-65139167 CTGTGCTTTGGGAGAGACGGTGG - Intergenic
910461359 1:87451125-87451147 CTGAGCTATGGGACAGTTTGAGG + Intergenic
910691027 1:89965973-89965995 CTGTGCTTTGGGAGAGATGGAGG - Intergenic
911075020 1:93864688-93864710 CTGTTCAATGGGGAGGTTGGGGG + Intergenic
911138317 1:94467306-94467328 CTGTGGGATGGGAAGGTTTGGGG - Intronic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912591358 1:110824295-110824317 CTGTGCTGTGGTGGGGTGGGGGG + Intergenic
912710486 1:111946233-111946255 GTGTGCATAGGGAGGGTTGGGGG + Intronic
912957541 1:114165993-114166015 CTGTGCTAACCTAGGGTTGGGGG + Intergenic
914331490 1:146674795-146674817 CTGAGATCTGGGAGAGTTGGGGG + Intergenic
915248138 1:154570370-154570392 AGGTGCAATGGGAAGGTTGGGGG + Intronic
915511052 1:156387341-156387363 CTGGGCTATGGGAGGCTTCATGG - Intergenic
916198391 1:162246783-162246805 CTGTGCTGTGGGGGTGTTGATGG + Intronic
917712978 1:177706085-177706107 CTGTGCTAATGCAGGGTTTGGGG + Intergenic
918697560 1:187562915-187562937 CTGTGATGTGGCAGGGCTGGTGG - Intergenic
920439802 1:205972435-205972457 CTGTGATAAGGGAGAGTAGGGGG + Intergenic
921188602 1:212690735-212690757 CTTTGCCATGGGAGGGTTTGAGG + Intronic
921500751 1:215899874-215899896 ATGTGGTCTTGGAGGGTTGGAGG - Intronic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923873097 1:238017524-238017546 CTGTGCTGTGGCAGTGATGGAGG - Intergenic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
1062997192 10:1877531-1877553 CTGGGCCATGGGAGGGGGGGTGG + Intergenic
1063118042 10:3085402-3085424 CTGTGCTGGGGAGGGGTTGGGGG - Intronic
1063118052 10:3085426-3085448 CTGTGCTGGGGAGGGGTTGGGGG - Intronic
1063118062 10:3085450-3085472 CTGTGCTGGGGAGGGGTTGGGGG - Intronic
1063118072 10:3085474-3085496 CTGTGCTGGGGAGGGGTTGGGGG - Intronic
1063118106 10:3085571-3085593 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118116 10:3085595-3085617 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118126 10:3085619-3085641 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118136 10:3085643-3085665 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118146 10:3085667-3085689 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063157539 10:3394224-3394246 CTGGGCAATGGGGGAGTTGGAGG + Intergenic
1064746033 10:18478885-18478907 CTTTGCTGTGGGAGGGATGTGGG + Intronic
1065540875 10:26765709-26765731 GTAGGCAATGGGAGGGTTGGTGG + Intronic
1065691212 10:28335759-28335781 CAGTGCTTTGGGAGGCCTGGTGG + Intergenic
1067090758 10:43264849-43264871 CTGTGCCAAGGCAGGGATGGGGG - Intronic
1067101373 10:43337062-43337084 CTGTGCTATGGTGTGATTGGTGG + Intergenic
1068610954 10:59059448-59059470 ATATGCTGTGGGAGGGTAGGAGG + Intergenic
1068720832 10:60244273-60244295 ATGAGACATGGGAGGGTTGGGGG - Intronic
1069173586 10:65262660-65262682 CTGTGCTAGGGCAGTGTGGGAGG - Intergenic
1069597309 10:69680652-69680674 CTGTCCTATAGGATTGTTGGAGG + Intergenic
1069857492 10:71449395-71449417 CTGTGCTGTGGGACGGTTCCAGG + Intronic
1069981481 10:72255610-72255632 TTTTGCTATGGCAGGATTGGGGG - Intergenic
1075086192 10:119415871-119415893 CTGTGCCATGAGTGGGTTGAAGG + Intronic
1075172840 10:120131863-120131885 TTGTGCTGAGGGTGGGTTGGAGG + Intergenic
1075856926 10:125637773-125637795 CTGTGCCATGAGATGGATGGGGG - Intronic
1076135927 10:128045744-128045766 CTCTGCTGTGGGCAGGTTGGAGG + Intronic
1076337835 10:129720438-129720460 CGGTGCTGTGGGAGGGTTGGGGG - Intronic
1076469398 10:130708145-130708167 CTTTCTTATGGGAGGGGTGGGGG + Intergenic
1076584839 10:131539645-131539667 CACTGCTGTGGGAGGCTTGGCGG - Intergenic
1077774744 11:5258522-5258544 CTGGGCAGTGGGGGGGTTGGTGG + Intronic
1077981255 11:7302976-7302998 CTGTGCAATGGGTGGGCTTGAGG + Intronic
1079216999 11:18522708-18522730 CAATGGTATGGGAGGTTTGGAGG - Intronic
1081617177 11:44597814-44597836 CTGTGCTGTGGGGTGGTTGTGGG + Intronic
1081908172 11:46682286-46682308 CTGTGCTAGGGGAGGGCCTGTGG - Intronic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1084214978 11:67642259-67642281 CAGGACTATAGGAGGGTTGGGGG + Intergenic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1085938092 11:81174663-81174685 CTGTGCTAGGGCAGGGTCTGTGG + Intergenic
1089624297 11:119741515-119741537 CTGCGCTATGGGGCGGTTGCAGG - Intergenic
1089629903 11:119778055-119778077 CTGGGCTAAGTGAGGGCTGGAGG - Intergenic
1090430146 11:126639114-126639136 CTGGGCTTTGGGATGATTGGGGG - Intronic
1090436903 11:126694536-126694558 CTGTTCTAGGGCAGGTTTGGGGG + Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091070584 11:132558922-132558944 CTGTGCTCTGGTTGGGATGGGGG - Intronic
1091086191 11:132724173-132724195 CTGTGCTAAAGAAGGGGTGGTGG - Intronic
1091321301 11:134654282-134654304 CTGTGCTATGTGAGGCCTGAGGG + Intergenic
1091837129 12:3593999-3594021 CTGTGAAGTGGGAGGGCTGGGGG + Intergenic
1095110151 12:38285964-38285986 TTATGGTATGGGAGGGTTGTTGG + Intergenic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097236049 12:57540379-57540401 CTGTCCTATGGGTGGGTTGAAGG + Intronic
1097328129 12:58302499-58302521 CTGTGTTTTGTGATGGTTGGGGG - Intergenic
1098630514 12:72716318-72716340 ATAAGCTATGGGAGGGTTAGGGG - Intergenic
1099445237 12:82744023-82744045 CTGTGCTCTGGGAGGCCAGGCGG + Intronic
1100900209 12:99231204-99231226 CTGTGTTTTGGGAGGGCTGTGGG + Intronic
1102574230 12:113845778-113845800 CTGTGCCGTGGGAGTGTTTGGGG - Intronic
1103563059 12:121802581-121802603 TTGTTCTATGGGTGGGTGGGGGG - Intronic
1104571484 12:129929829-129929851 CTGTGCCATGCAAGGGCTGGAGG - Intergenic
1104610730 12:130225655-130225677 GTGTGCTGGGGGAGGGGTGGGGG - Intergenic
1104815023 12:131640569-131640591 CTGTGCTGGGGAAGGGTTGAGGG + Intergenic
1104958543 12:132477426-132477448 CTGTGGTGGGGGAGGGGTGGGGG - Intergenic
1105726619 13:23169147-23169169 CTGTGCTCTGGGTGGGAAGGGGG - Intergenic
1108268328 13:48734061-48734083 CTGAGCTCTGTGAGGGTTGTTGG + Intergenic
1110108109 13:71705650-71705672 TTTTGCTATGGAAGGATTGGAGG - Intronic
1111658879 13:91184539-91184561 CTGTGTTGTGGCAGGGATGGAGG + Intergenic
1111977605 13:94983159-94983181 CTGTGCTTTGGTAGCTTTGGAGG + Intergenic
1114277290 14:21158357-21158379 CTGTGCTATCCCAGGGATGGGGG - Intergenic
1114339612 14:21729479-21729501 CTGTGATATGCAAGAGTTGGTGG + Intergenic
1114491763 14:23106796-23106818 CTGTGCTTTGGGAGAGATGAGGG - Intergenic
1116638164 14:47424810-47424832 CTAGGCAATGGGAGGGTAGGTGG - Intronic
1118199963 14:63662772-63662794 CTGTGTTATGGGATCCTTGGGGG + Intergenic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1121445126 14:93973873-93973895 CTGTGCTAGGGCAGGGGTGCTGG - Intronic
1122249449 14:100427782-100427804 CTGGGCAATGGGTGGGGTGGTGG - Intronic
1126035732 15:44543884-44543906 CAGTGATATGGGTGGGGTGGGGG + Intronic
1126329247 15:47514104-47514126 ATGTGGTATGGGAGACTTGGAGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1128980789 15:72184209-72184231 CTGTGCTAGCCGAGGGGTGGAGG - Intronic
1129294914 15:74594870-74594892 CTGTGGTTTGGGAGGGTTGGGGG + Intronic
1132663444 16:1071481-1071503 CACTGCTGTGGGAGGGTGGGAGG + Intergenic
1135393615 16:22114464-22114486 TTGTGCTATGTGAGGGTCTGGGG - Intronic
1135624590 16:23982752-23982774 CTGTAATAAGGGAGGGTGGGAGG + Intronic
1135705465 16:24671041-24671063 CAGTGCTGTCGGAGGGTTGCTGG - Intergenic
1139078132 16:63480319-63480341 CTGTGCATTGGGATGCTTGGGGG - Intergenic
1140002064 16:71036105-71036127 CTGAGATCTGGGAGAGTTGGGGG - Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1141473083 16:84252615-84252637 CTGTGAGATGGGAGGCCTGGAGG + Intergenic
1143167268 17:4903090-4903112 CTGAGCTCTGGCAGGCTTGGAGG + Intergenic
1143188505 17:5024420-5024442 CGCTGCTATGGGTGGGGTGGGGG + Exonic
1143798758 17:9359933-9359955 CTGTGCTTTGGGAGGGACAGAGG + Intronic
1143847411 17:9783010-9783032 CTGTGGTATTGGAGAGATGGAGG + Intronic
1144110039 17:12021597-12021619 CTGTGCGCTGGAAGGGATGGGGG + Intronic
1144796506 17:17895107-17895129 CTGTCCTATGGGAGGATAAGAGG - Intronic
1145102015 17:20085272-20085294 CTGTGCTCTTTGAGGGTCGGGGG + Intronic
1145254705 17:21316251-21316273 CTGTGCCAGGGAAGGGTTAGTGG - Intergenic
1145321892 17:21771714-21771736 CTGTGCCAGGGAAGGGTTAGTGG + Intergenic
1147427899 17:40355038-40355060 CTGGGCTCAGGGAGGGTTTGGGG + Intronic
1148454300 17:47802695-47802717 CTGGGCTCTGGGAGGGGTGTGGG - Intergenic
1150442419 17:65202241-65202263 CGCTGCTTTGGGAGGTTTGGGGG + Intronic
1151617010 17:75219921-75219943 CTGTGCTATGTAGGGGTAGGTGG + Intronic
1151683599 17:75634390-75634412 CTGCACTAGGGGAGGGCTGGGGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151885076 17:76918659-76918681 ATGGGCCATGGCAGGGTTGGGGG + Intronic
1152082527 17:78197228-78197250 CTGTGCTGGGGCAGGGTTGTTGG + Intronic
1155733530 18:29192304-29192326 CTGTGCTTTGGGAGAGTCAGAGG - Intergenic
1156506686 18:37600285-37600307 CTTTGCTCTGGGTGGGTGGGGGG - Intergenic
1156610901 18:38722965-38722987 CTGAACTATGGCAGGGCTGGAGG - Intergenic
1157562359 18:48657480-48657502 CTGAGAGAAGGGAGGGTTGGTGG - Intronic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1160924226 19:1535336-1535358 CTGTCCTGGGGGAGGGCTGGGGG + Exonic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162140076 19:8580437-8580459 GTCTGCTATGGGAGGGGGGGGGG - Exonic
1162345779 19:10117189-10117211 CTGGGCTCAGGGAGGGATGGGGG + Intronic
1162959761 19:14118584-14118606 CTGTGCAATGGGAGTGATGATGG - Intergenic
1163519021 19:17781030-17781052 CTGGTGTCTGGGAGGGTTGGGGG + Intronic
1163796710 19:19342181-19342203 CTGTGCTCTGAGGGGGTGGGAGG - Intronic
1164155529 19:22594667-22594689 TGGTGCTCTGGGAGGGTGGGGGG + Intergenic
1164610584 19:29628898-29628920 CTGTGCTGTGGGAGTAATGGGGG + Intergenic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1164902364 19:31938921-31938943 CTGTGGGATTGGGGGGTTGGGGG + Intergenic
1166037946 19:40182909-40182931 CTGGGCTTTGGCAGGGCTGGAGG - Intergenic
1166190755 19:41175011-41175033 CTCTGTTCTGGGAGTGTTGGGGG + Intergenic
1167710612 19:51108272-51108294 CGGTGCCGTGGGAGGGTTGAGGG - Intronic
1168267547 19:55230820-55230842 CTGTGGTCTGGGGGGGCTGGTGG + Exonic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
925746606 2:7049027-7049049 CTCTCCTATGAGAGGGTTTGTGG + Intronic
925842276 2:8003652-8003674 CTGGGATATGGCAGGGATGGGGG + Intergenic
926146208 2:10398489-10398511 CTGGGCTGTGTGAGGGGTGGAGG + Intronic
926159267 2:10476201-10476223 CTGGGCAATGGTAGGGCTGGAGG + Intergenic
926428787 2:12765214-12765236 GTTTGCTATCTGAGGGTTGGAGG - Intergenic
928759899 2:34570031-34570053 CTGTGATATTTGAGGGTTTGGGG + Intergenic
931901204 2:66790225-66790247 CTGGGCAATGGGAGAGTTTGTGG + Intergenic
934579598 2:95427635-95427657 CTGTGCTCTGGGCGGGGAGGGGG + Intergenic
936533191 2:113291094-113291116 CTGTGCTCTGGGCGGGGAGGGGG - Intergenic
938101344 2:128499947-128499969 CTGTGTTATGGCTGGGGTGGCGG + Intergenic
939208187 2:139134839-139134861 CTGTGAGGTGGGTGGGTTGGGGG - Intergenic
940254441 2:151714134-151714156 CTGTGCTTTGGGAGAGTTGGAGG - Intronic
941774021 2:169372297-169372319 AGGTGCTCTGGGAGAGTTGGAGG - Intergenic
942496586 2:176546639-176546661 CTGTGCAATGGGAGACTTGCTGG + Intergenic
945005290 2:205398919-205398941 GTGTGCTGGGGCAGGGTTGGGGG + Intronic
945264520 2:207877879-207877901 CAGTGCTATGGGAATGGTGGTGG - Intronic
946208844 2:218130959-218130981 CTGTGCTGGGGGTGGGCTGGAGG - Intronic
946563296 2:220936993-220937015 CTGTGCAAAAGGAGGTTTGGGGG + Intergenic
948226190 2:236311069-236311091 CTGTGCTCAGGGAGCCTTGGGGG + Intergenic
1171193739 20:23180666-23180688 CTGTGCTGGGTGAGGGGTGGAGG + Intergenic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1173673324 20:44812797-44812819 CTGTGAGATGGGAGGGTTTGGGG - Intergenic
1175300271 20:57937970-57937992 CTGGGGCATGGGAGGTTTGGTGG + Intergenic
1176023905 20:62976174-62976196 CTCTGCTGGGGGAAGGTTGGGGG - Intergenic
1176124893 20:63471010-63471032 CTGTGATATGAGAGGGTTCTGGG - Intronic
1178049316 21:28730932-28730954 CAGTGCTCTGGGAGGATTGGAGG + Intergenic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1179893610 21:44349972-44349994 GTGTGCCTTCGGAGGGTTGGGGG - Intergenic
1179951736 21:44712162-44712184 CTGTGCTCTGCGGGGGGTGGGGG + Intergenic
1180036473 21:45252815-45252837 GTGTGCAATGGGAGGGGTGTCGG + Intergenic
1180251722 21:46594581-46594603 CCATGCAATGGGAGTGTTGGTGG + Intergenic
1181688328 22:24544079-24544101 CTGTGCTGTGGGCGGGAGGGGGG + Exonic
1181750498 22:24985892-24985914 CTGTGTTTTGCGAGGGTTGTGGG + Intronic
1182550164 22:31096675-31096697 CTGTGCTGTGTGGGTGTTGGTGG + Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183353063 22:37344276-37344298 CTGGGCTGTGGGAGGGTTGGTGG - Intergenic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184122634 22:42462444-42462466 CTGTGCTTTGAGGGGGTTTGAGG + Intergenic
1184159417 22:42689046-42689068 CTGTGCTGCGGTGGGGTTGGGGG + Intergenic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184784963 22:46667143-46667165 ATGTGGTATGGCAGGGGTGGGGG + Intronic
1185110545 22:48897917-48897939 CTGTGCTTGGGCAGGGGTGGAGG - Intergenic
1185252498 22:49811860-49811882 CTAGGCTATGGGTGGGTTTGTGG + Intronic
1185276044 22:49950548-49950570 CTGTGTTATAGGGGGGTGGGGGG + Intergenic
949265656 3:2153468-2153490 CAGTTTTATGGGAGTGTTGGAGG + Intronic
949364650 3:3267730-3267752 CTGTTCTATGGGAAGGTAGTGGG + Intergenic
950888879 3:16385652-16385674 CTGTGCAATGGAATGGCTGGGGG - Intronic
951517675 3:23579440-23579462 CAGTGCTTTGGGAGGCTAGGTGG + Intronic
952450236 3:33425093-33425115 CAGTGATATGAAAGGGTTGGTGG - Intronic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
953180423 3:40589654-40589676 CTTTGCCATAGGAGGATTGGGGG + Intergenic
954385570 3:50242196-50242218 CTCTGCTGTGGGTGGGGTGGGGG - Intronic
959113786 3:102152098-102152120 CTTTGCTAGGGGAGTGTTGAAGG - Intronic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963983754 3:151568684-151568706 CTATTGCATGGGAGGGTTGGAGG - Intergenic
964558189 3:157964113-157964135 CTGTTTTGTGGGGGGGTTGGGGG + Intergenic
966457582 3:180135301-180135323 CTGTGCTTTGGGAGAGGTAGAGG - Intergenic
966695869 3:182790562-182790584 TTGTGCTTTGGGAGAGATGGTGG - Intergenic
966861846 3:184234884-184234906 CTGTCCTCTGTGATGGTTGGTGG - Intronic
967192501 3:186997014-186997036 CTGTGCTTTGGCTGTGTTGGAGG + Intronic
968054270 3:195679225-195679247 CAGTGCTTTTGTAGGGTTGGAGG + Intergenic
968101617 3:195969921-195969943 CAGTGCTTTTGTAGGGTTGGAGG - Intergenic
968950491 4:3688867-3688889 CTGTGGGATGTGAGGGCTGGTGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969444108 4:7234425-7234447 CTGTGCTGTGCAAGGGTTGTTGG + Intronic
972995147 4:44870229-44870251 TTGTGCTTTGGGTGGGGTGGGGG + Intergenic
973955460 4:56058952-56058974 CTGTGCATTGTGAAGGTTGGAGG + Intergenic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
974294592 4:59980744-59980766 TTGTGCTTTGGGAGAGATGGTGG - Intergenic
975589351 4:75985104-75985126 CTGGGCCATGGGTGGGGTGGGGG - Intronic
975997491 4:80332981-80333003 CTGTGCTATGGGATAGATGATGG - Intronic
977439192 4:97040596-97040618 CAGTGCTTTGGGAGGCTAGGTGG - Intergenic
978607169 4:110493527-110493549 GTCTTCTATGGAAGGGTTGGAGG - Intronic
979557210 4:122062469-122062491 CTGAACAATGGGAGGGTTAGGGG - Intergenic
982202674 4:152975123-152975145 CTGTGCTGAGGGTGGGTTGGGGG - Exonic
985500573 5:241887-241909 CAGTACTATTGTAGGGTTGGAGG + Intronic
986024602 5:3838743-3838765 CTCTGCTGGGGGAGGGGTGGCGG + Intergenic
986110125 5:4707668-4707690 CTGTCCAATGTGAGAGTTGGTGG - Intergenic
986146433 5:5082392-5082414 CTGTGCTTTGGGAGAGTCAGAGG - Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986789992 5:11150183-11150205 CTGTGCTATGGAAGAGTGAGAGG - Intronic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
990535354 5:56716238-56716260 CTGAGCACTGGGAGGATTGGAGG - Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
991440888 5:66647663-66647685 CTGTGGTATGGGAGTGATGTGGG + Intronic
991629641 5:68643667-68643689 TTGTGCTATGGAGGGGGTGGGGG - Intergenic
996581241 5:125034637-125034659 CTGGGTCATGGGAGGGGTGGGGG - Intergenic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
999127164 5:149254261-149254283 CCCTCCTATAGGAGGGTTGGAGG - Intronic
999808792 5:155108668-155108690 CTGGACTATGGGAGCTTTGGTGG + Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000729762 5:164818950-164818972 GAGTGCTATGGGTGGGGTGGTGG + Intergenic
1001667220 5:173443356-173443378 CTGTCACCTGGGAGGGTTGGAGG + Intergenic
1001880997 5:175243934-175243956 CTGTGCTGTGGAATGGTTGCAGG - Intergenic
1002160160 5:177310354-177310376 CTGTGCTATGGAGGGGCTGGTGG - Intronic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1002849825 6:983692-983714 CTGGGCTATTGGGGGGTGGGGGG + Intergenic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1004370069 6:15044588-15044610 CTGTGCTTTGGGAGAGGTAGAGG - Intergenic
1004494920 6:16154545-16154567 CAGTGCTGTGGGTGGGTTGGGGG - Intergenic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007396141 6:41578858-41578880 CTCTGCTGGGGGAGGGGTGGGGG - Intronic
1007774099 6:44214942-44214964 ATGTGCTATTGTAGGGTTGTGGG - Intergenic
1010097598 6:72064479-72064501 CTGTCCTCTGGGAGGGAGGGAGG + Intronic
1010579343 6:77574923-77574945 CTGTGCTTTGGGAGAGATAGAGG - Intergenic
1011601855 6:89067064-89067086 CCGTGCTTTGGGAGAGATGGTGG - Intergenic
1012150611 6:95746214-95746236 GTGGGCCATGGGAGGGTTTGAGG - Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1016696951 6:147007462-147007484 CTATTCTTTGGGAGGGCTGGGGG - Intergenic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1017436635 6:154421727-154421749 CTTTACCAGGGGAGGGTTGGGGG - Intronic
1017922271 6:158882844-158882866 CTTTGCTAGAGGAGGATTGGAGG + Intronic
1018946061 6:168347306-168347328 CTGTGCTCTGGGCGGGTTCTCGG - Intergenic
1019311851 7:366145-366167 CTGTGCTATGAGAGGCTGGGAGG - Intergenic
1019443021 7:1056849-1056871 CTGTGCTTTGGCGGGGTGGGGGG + Intronic
1019632333 7:2056370-2056392 CTCTTCTGTGGGAGGGATGGAGG + Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022034431 7:26520283-26520305 TTGTGATATGGGAGGGTTCGTGG - Intergenic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1023364627 7:39451535-39451557 CTGACGTCTGGGAGGGTTGGTGG - Exonic
1023713022 7:43014634-43014656 CTGTGCAATGGAAGGGTAGGTGG + Intergenic
1024362081 7:48478783-48478805 CTGTGCTTTGGGAGAGATGGTGG + Intronic
1025274873 7:57571278-57571300 GTGTGTTATGGAAGGGCTGGAGG - Intergenic
1026189628 7:68112961-68112983 GTGTGGTGTGGGAGGGTTGAAGG + Intergenic
1026194195 7:68158340-68158362 CTGTGCTTTGGGAGAGATGGTGG - Intergenic
1026365406 7:69643638-69643660 CTGTGCTGGGGGCGGGGTGGGGG - Intronic
1026742980 7:72990441-72990463 CTGTGCTGGGGGTGGGATGGGGG + Intergenic
1027297549 7:76793260-76793282 CATTGTTATGGGAGGGGTGGAGG - Intergenic
1029180961 7:98701514-98701536 CAGTGCTATGGGTGAGGTGGAGG - Intergenic
1029535251 7:101154228-101154250 CTGTCCTGTGGGCTGGTTGGAGG - Intergenic
1030819686 7:114081350-114081372 CTATGCCATTGGAGGATTGGAGG + Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1034726198 7:153338261-153338283 TGGTGCTATGGGAAGGTAGGGGG - Intergenic
1035269999 7:157713857-157713879 GTGTGCCATGTGAGGGCTGGAGG - Intronic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1036572162 8:9989957-9989979 CTGTGGTAGGGAAGAGTTGGAGG + Intergenic
1038247113 8:25869081-25869103 TTGTGCTATTGCAGGATTGGTGG - Intronic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1041024117 8:53666489-53666511 CTGTGGTGTGGAAGGGGTGGTGG - Intergenic
1043660741 8:82736922-82736944 ATGAGTTGTGGGAGGGTTGGTGG + Intergenic
1043740317 8:83802446-83802468 CTTTGCCAGGGGAGAGTTGGTGG + Intergenic
1045643993 8:104282482-104282504 CTGTGCTTTGAGAGAGATGGTGG - Intergenic
1045886033 8:107098793-107098815 CTGTGTTTTGGGAGAGATGGAGG + Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1049395469 8:142398224-142398246 GTGCGCTTTGGGAGGGTTTGGGG - Intronic
1049395528 8:142398404-142398426 ATGTGCTTTGGGAGGGTTTGGGG - Intronic
1049586521 8:143434970-143434992 CTGTGCTCTGGCAGGGGTGGAGG - Intergenic
1049747514 8:144269276-144269298 CTGTGGCCTGGCAGGGTTGGGGG - Intronic
1050519201 9:6479469-6479491 TGGTGCTTTGGCAGGGTTGGGGG - Intronic
1050767250 9:9150320-9150342 TTGTGCTAGCGTAGGGTTGGGGG + Intronic
1052558992 9:30059434-30059456 CTTTGCTTGGGGAGGGTTGTTGG + Intergenic
1053562204 9:39208235-39208257 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1053828011 9:42046236-42046258 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1054134914 9:61410723-61410745 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1054602546 9:67141210-67141232 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1056410431 9:86320998-86321020 CTGGGCTATGTAAAGGTTGGTGG - Intronic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057597038 9:96423471-96423493 CAGTGCTTTGGGAGGCTGGGGGG - Intergenic
1057797670 9:98170213-98170235 CAGTCCTATGGGTGTGTTGGTGG - Intronic
1057944447 9:99312771-99312793 CTAGGCTACAGGAGGGTTGGGGG + Intergenic
1060632351 9:125170815-125170837 CTGTGGAATGGTGGGGTTGGGGG - Intronic
1061816730 9:133201824-133201846 CTGTCCCATGAGAGGGATGGGGG + Intergenic
1186039781 X:5463102-5463124 CTGTGCTTTAGGAGAGCTGGTGG + Intergenic
1186169054 X:6858033-6858055 CTATGTGATTGGAGGGTTGGGGG + Intergenic
1186466829 X:9789949-9789971 CTGTGGTCTGGGACGCTTGGAGG + Intronic
1186564699 X:10650383-10650405 CTGTGCTTTGGGAGAGATAGAGG - Intronic
1187838206 X:23457728-23457750 CTCTTTTATGGCAGGGTTGGTGG + Intergenic
1190233964 X:48602000-48602022 CTGTGCCCTGGGAGGGCTGGAGG - Intronic
1190688973 X:52897815-52897837 CTGTGCGATGGGAGAGGAGGTGG - Exonic
1190697010 X:52957977-52957999 CTGTGCGATGGGAGAGGAGGTGG + Intronic
1190744327 X:53312543-53312565 CTGTGCTGTGGGAGGACAGGAGG - Intronic
1190842041 X:54154254-54154276 GTGGGGTATGGGAGGGGTGGGGG + Intronic
1196075374 X:111569728-111569750 TGGTGCTATGGGAGAGCTGGAGG + Intergenic
1200153391 X:153962564-153962586 CTGTGCTGGGGGAGGAGTGGTGG + Intronic