ID: 989256302

View in Genome Browser
Species Human (GRCh38)
Location 5:39369294-39369316
Sequence CTCCAGCAAGACCATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989256302_989256306 12 Left 989256302 5:39369294-39369316 CCCACACCATGGTCTTGCTGGAG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 989256306 5:39369329-39369351 ATGATTTCAGTATGTGGTAGAGG 0: 1
1: 0
2: 1
3: 15
4: 191
989256302_989256305 6 Left 989256302 5:39369294-39369316 CCCACACCATGGTCTTGCTGGAG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 989256305 5:39369323-39369345 ACTTGTATGATTTCAGTATGTGG 0: 1
1: 0
2: 1
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989256302 Original CRISPR CTCCAGCAAGACCATGGTGT GGG (reversed) Intronic
900998640 1:6136344-6136366 CTCCTGCAGGAGCAGGGTGTTGG - Intronic
901817639 1:11803905-11803927 CTCCAAAAAGACCGTGTTGTGGG + Intronic
903352150 1:22723755-22723777 CTCAAACAACACCATGGGGTAGG - Intronic
904568497 1:31442993-31443015 CTCCAGCAAGTCTGTGGGGTAGG - Intergenic
906383052 1:45344982-45345004 CTCCAGGAAGAAAATGGTTTTGG - Exonic
907388913 1:54143933-54143955 CTCCACCCAGACCCTCGTGTGGG + Exonic
907982675 1:59499363-59499385 GTCCAGCAAATCCATGCTGTAGG - Intronic
908056067 1:60288717-60288739 CTCCAGCTAGAGCATGGTAACGG + Intergenic
911742152 1:101398403-101398425 ATCCAGCAATTCCATGTTGTTGG - Intergenic
912953960 1:114139740-114139762 CTCCAGGAAGCCCAGGGTGCTGG + Exonic
913349551 1:117842565-117842587 CACCATAAAAACCATGGTGTGGG - Intergenic
915326205 1:155082369-155082391 GTCCAACAAGACCAGGGAGTAGG - Intronic
917454293 1:175172601-175172623 CTCCACCACTAACATGGTGTGGG + Intronic
917506254 1:175629685-175629707 CTCCACTTTGACCATGGTGTTGG - Intronic
918038776 1:180899473-180899495 CTCCAACAAGCCCAGGCTGTGGG - Intergenic
919267985 1:195297972-195297994 CTTCAGCAAGCCCATGGCTTGGG + Intergenic
919562497 1:199139264-199139286 AGTCAGCAAGACCATGGTTTTGG + Intergenic
919625705 1:199908107-199908129 CTCCAGCAAGATGAGGGTGGAGG - Intergenic
920442785 1:205992507-205992529 CCCCAACAACACCATGGGGTAGG + Exonic
923025377 1:230199749-230199771 CTTCAACAGGACCCTGGTGTGGG - Intronic
923430414 1:233914402-233914424 CTGCAGCAAGACATTGATGTAGG - Intronic
924668195 1:246095158-246095180 CACCCGCAAGCCCATGGTGTGGG - Intronic
924955669 1:248924183-248924205 CTCCAGCAAGACCTGGGAGATGG - Intergenic
1063289339 10:4727565-4727587 CTACAGCACAACCCTGGTGTCGG - Intergenic
1064526161 10:16259092-16259114 CTCCACCAACACCAGGGGGTGGG + Intergenic
1065165985 10:22977520-22977542 AACCTGCAAGACCATGGTGAAGG - Intronic
1068454665 10:57238909-57238931 ATCCTGCAAAACCATGGTGGTGG + Intergenic
1069675453 10:70243570-70243592 CTGCAGCAAGACCAAGATGGTGG - Intergenic
1070791103 10:79189977-79189999 CTCCAGAAAGCCCATGGCATGGG - Intronic
1072275662 10:93820364-93820386 CTACTGCAATACCATGGTCTCGG - Intergenic
1072683346 10:97522338-97522360 CTCTCACAAGGCCATGGTGTGGG - Intronic
1072759116 10:98041333-98041355 TCACAGCAATACCATGGTGTAGG + Intergenic
1074705509 10:116126409-116126431 CTGCAGCGAGAGCATGGTGGAGG + Intronic
1076668861 10:132108209-132108231 CTCCAGCAGGACCAAGGTCCAGG - Intronic
1076697985 10:132256276-132256298 CTCCAGCAGGACCCTGTTGGCGG + Intronic
1077546092 11:3170691-3170713 CTCCAGCACCACCATGGGGCAGG - Intergenic
1080910665 11:36594715-36594737 CTCCAGCAATACCAGGGTAGCGG - Exonic
1083410510 11:62489294-62489316 CTCCAGCAACACCCTAGTGCTGG - Intronic
1084323570 11:68386644-68386666 CTCCCGCAAGATCCTGGTGTCGG + Exonic
1084727838 11:70953488-70953510 CCCCGGCAAGACACTGGTGTAGG + Intronic
1089778114 11:120853352-120853374 CTCCAGCAATAACATGGAGAAGG + Intronic
1094425368 12:30311150-30311172 CTCCAGCAAGAGCATAGAGTTGG + Intergenic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1096541447 12:52309596-52309618 CTCCAGGAAGGCCCTGGGGTGGG - Intergenic
1096908952 12:54962888-54962910 CTCCAGCAAGACTCTGATTTGGG - Exonic
1100452692 12:94722677-94722699 CTCCAGCAAGGCCAAGGAATGGG - Intergenic
1104328264 12:127820330-127820352 CTGCAGCAAGAGCATGGTGCAGG + Intergenic
1105296206 13:19089789-19089811 CTCCAGCAAGCCCAAGAAGTGGG - Intergenic
1105415972 13:20211537-20211559 CTCCACCAACACCATGGTGGGGG - Intergenic
1105837342 13:24223198-24223220 CCCCACCAGGACCATGGAGTGGG - Exonic
1106198002 13:27510402-27510424 CTTTAGCAAGACCATTCTGTTGG - Intergenic
1106582827 13:31032408-31032430 CTCCAACAACACCATGTTGAAGG + Intergenic
1109734763 13:66468185-66468207 CTTCAGAAATACCATGGTGGTGG - Intronic
1116051163 14:39804852-39804874 CTCCAGAAAGAACATGATATGGG - Intergenic
1120968161 14:90185663-90185685 CTGCAGCAAGATGGTGGTGTAGG + Exonic
1121248561 14:92482827-92482849 CACCAGCCACACCATGATGTAGG - Exonic
1122037168 14:98957263-98957285 CTCCAGCCAGAACATGGTAGCGG - Intergenic
1122859808 14:104577469-104577491 CTCCAGCCAGACCATGGTCCAGG + Intronic
1129217036 15:74106487-74106509 CTCCAGGAAGCCCATCCTGTTGG + Intronic
1132713429 16:1279149-1279171 CTCCAGGAAGCCCATGCAGTGGG + Intergenic
1134906475 16:17983846-17983868 CTCCAGCTACATCATGGGGTCGG - Intergenic
1135061116 16:19272158-19272180 CTTCTGCAAGTCCAAGGTGTGGG - Intergenic
1135290506 16:21233682-21233704 CTCCAGGCAGAGCAAGGTGTTGG - Exonic
1135959534 16:26984269-26984291 CTCCAGCAAACCACTGGTGTAGG + Intergenic
1136287481 16:29252991-29253013 CACCCCCAAGGCCATGGTGTTGG + Intergenic
1140730075 16:77848457-77848479 CTCCAGCAAGATCATGGACCAGG - Intronic
1141863880 16:86736445-86736467 ATCCAGTAGGATCATGGTGTTGG - Intergenic
1142093099 16:88225620-88225642 CACCCCCAAGGCCATGGTGTTGG + Intergenic
1142408654 16:89905006-89905028 CTCCAGCCAGCTCATGGTGGCGG - Exonic
1144668119 17:17115827-17115849 GGCCACCAAGTCCATGGTGTTGG - Intronic
1146570662 17:33950030-33950052 CTCCTGCAAGACCTGGGTCTTGG + Intronic
1148131767 17:45266576-45266598 CTCCAGCTGGAACATGGTGCTGG - Exonic
1149005298 17:51798914-51798936 CTCCAGGAAGAACATGATGTGGG + Intronic
1149371236 17:55995211-55995233 CTCTACCAAGACCATAATGTTGG - Intergenic
1149451642 17:56754396-56754418 ATCCAGGAAGTCCATGTTGTGGG + Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1151556082 17:74847418-74847440 CACCAGCAAGATCATGGTTCTGG - Exonic
1160476977 18:79200188-79200210 CTGCAGCATGACCATGTGGTAGG + Intronic
1162341388 19:10093415-10093437 CTCCAGCATCACCATGGTACTGG + Exonic
1162739585 19:12766346-12766368 GCCCAGCCAGACCATGGGGTTGG + Intronic
1164539095 19:29109032-29109054 CACCAGCAAGGCCAATGTGTGGG + Intergenic
1165112208 19:33509060-33509082 CTCCAGCAAGACCTGGCTGCAGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167254619 19:48419682-48419704 CACCAGCAAAATCATGGTGCTGG + Exonic
1167323093 19:48808120-48808142 CACCAGCAAGACCACGCTGCAGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925487293 2:4349494-4349516 TTCCAGCAAGTCAATGTTGTAGG + Intergenic
930959073 2:57237020-57237042 CTTCAGCAAGACCATGGAAGAGG + Intergenic
931977684 2:67661160-67661182 CTCCAGCATAACTAGGGTGTGGG - Intergenic
935116958 2:100144985-100145007 CTCCAGAAAGACCTGGGTTTGGG + Intergenic
939237861 2:139520802-139520824 CACCAGCACGATCAAGGTGTGGG - Intergenic
942088160 2:172462542-172462564 CTTCTGCAAGAGCTTGGTGTGGG + Intronic
942344835 2:174991793-174991815 CTACAGGAATACCATGGTTTAGG + Intronic
942889170 2:180965857-180965879 CTCCAACAATACTTTGGTGTCGG + Intergenic
944586572 2:201178658-201178680 CTGCAGCCACACCCTGGTGTTGG - Intergenic
946219942 2:218217463-218217485 CTCCAGCAGGATCATGGCGGCGG - Exonic
947517710 2:230821942-230821964 CTCCAGCATGAACAAGGTATTGG - Intergenic
1174172023 20:48623726-48623748 GTCCGGCACGACCATGTTGTGGG + Intergenic
1174269013 20:49353428-49353450 CTCCAGTAAGTCCAGGGTGTTGG - Intergenic
1176143347 20:63554546-63554568 CTCCAGCAAGAGCAGGGCTTAGG + Exonic
1177358055 21:20033749-20033771 CTCTAGAAAGACCATGATTTAGG + Intergenic
1180023285 21:45142911-45142933 GTGCAGCATGGCCATGGTGTTGG - Intronic
1180149514 21:45940533-45940555 CTCCAGAAAGACCAATGTTTGGG + Intronic
1180589816 22:16927953-16927975 CTCCAGCAAAAGCATGGAGTAGG + Intergenic
1181175335 22:21031969-21031991 CTCCAGCAGGCCCCTGGTGAGGG - Intronic
1182309299 22:29393352-29393374 CTCCTGCCAGATCATGCTGTGGG - Intronic
1184948655 22:47823083-47823105 CTCCTGCCCGACCATGGTGTGGG - Intergenic
950881070 3:16323047-16323069 CTGCAGCCTGACCATGGGGTGGG - Intronic
951902527 3:27670891-27670913 CCACAGCCAGAACATGGTGTAGG + Intergenic
954133188 3:48570318-48570340 CTCCAGGGAGACCCTGGAGTAGG - Exonic
954854910 3:53635620-53635642 CTCCTGCAAGACAGTGCTGTTGG + Intronic
955326042 3:58009783-58009805 TTTCAGGAAGACCCTGGTGTAGG - Intronic
956524177 3:70139450-70139472 GCCCAGCAAGGCCATGGGGTAGG - Intergenic
961960033 3:130845288-130845310 CTCCAACATGCCCATGGTTTGGG - Intergenic
966909205 3:184549209-184549231 CTACAGCTAGACCATGTTCTTGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
976513090 4:85932917-85932939 CTGCAGCAAGAGCAAGGTGGCGG - Intronic
979399597 4:120232397-120232419 CTACAGAAAGAGCATAGTGTGGG + Intergenic
981301055 4:143185687-143185709 CTTCAACAAGACCTTCGTGTTGG + Exonic
987187695 5:15442184-15442206 CTCCATGAAGACCATGCTTTGGG - Intergenic
989256302 5:39369294-39369316 CTCCAGCAAGACCATGGTGTGGG - Intronic
993713596 5:91252241-91252263 CTCTAGCCAGAGGATGGTGTAGG - Intergenic
995478772 5:112574368-112574390 CTTCAGAAAGAGCATAGTGTTGG - Intergenic
997523031 5:134535407-134535429 TTCCAGGAGGACCATGCTGTCGG - Intronic
999747159 5:154601085-154601107 CTCCAGAATGACCTGGGTGTTGG + Intergenic
1000456135 5:161451849-161451871 ATACAGCAAGACCAAGGTGGTGG + Intronic
1001725201 5:173890610-173890632 CTCCAGGAAGAGGAGGGTGTTGG - Exonic
1002079591 5:176729428-176729450 CTCCAGTAAAACCATGTTTTGGG - Intergenic
1002339856 5:178508686-178508708 CTCCACCAACACCATGGAGAAGG + Intronic
1002541519 5:179908954-179908976 CTCTAGCCAGACCCTGGTGAGGG - Intergenic
1003031259 6:2603437-2603459 CTTCAGCAAGACCAGAGTGAGGG + Intergenic
1003561174 6:7181956-7181978 TTCCATCAACACCATGATGTCGG + Exonic
1005893648 6:30160451-30160473 CTCCAGGAAGCGCATGGTGTGGG + Exonic
1006116542 6:31778904-31778926 CTCCATCAAAACCCTGGTCTGGG - Intronic
1006375711 6:33670721-33670743 CTCCACGAACTCCATGGTGTTGG - Exonic
1007008254 6:38388280-38388302 CTGGAGCCAGACCATGTTGTTGG + Intronic
1007783049 6:44265089-44265111 CCCCAGCAAGGACAGGGTGTAGG + Exonic
1008044060 6:46833652-46833674 CTCCAACAAGACTATGTTATTGG - Intronic
1011670511 6:89678817-89678839 CTCCAGAAGGTCCCTGGTGTTGG - Intronic
1015695522 6:135975911-135975933 CTCCAACCAGGCCATGGAGTTGG + Intronic
1017647127 6:156549668-156549690 CCCCAGCAAGTTCATGGTCTTGG + Intergenic
1022443582 7:30452472-30452494 GGCCAGCAAGACCAGGGGGTGGG + Exonic
1022865262 7:34411337-34411359 TTCCAGCAAGATCCTTGTGTTGG + Intergenic
1023510286 7:40945481-40945503 CTCCTGCAGGAGCTTGGTGTGGG - Intergenic
1030921171 7:115390145-115390167 CTCCAGTAAGAGCAGGATGTAGG + Intergenic
1031959722 7:127977879-127977901 CTCCAGCATGACCATCCTCTTGG - Intronic
1035255424 7:157622792-157622814 CTCAAGCAGGGCCATGGTGGGGG - Intronic
1035305048 7:157926775-157926797 GTCCAGCAAGATCAGGGTGAAGG - Intronic
1038346099 8:26733838-26733860 CTCCAGAATGACCATGGGGGTGG - Intergenic
1041754165 8:61295109-61295131 CTCCGGCAAGGCCAAGGTGGAGG - Intronic
1045955472 8:107900798-107900820 CTCTAGCATGTCCATGGTGCCGG + Exonic
1049653980 8:143789707-143789729 CTCCAGCCAGAGCATGGGGCAGG + Intergenic
1049706792 8:144046823-144046845 CTGCAGGAAGTCCACGGTGTAGG - Exonic
1051510648 9:17874314-17874336 CAACAGCAAAATCATGGTGTTGG - Intergenic
1052996225 9:34552855-34552877 CTGCAGCCAGACCATGGGGTGGG + Intronic
1055854521 9:80669912-80669934 CTACTGCAGGACCAAGGTGTGGG - Intergenic
1057263545 9:93599399-93599421 CTCCAGCAAGCCCAAGAAGTGGG + Intronic
1060370633 9:123067183-123067205 CTGCAGCAGGACAATGGTATGGG - Intronic
1061491843 9:130949254-130949276 CTCCAGGAAGGGCATGGAGTGGG + Intergenic
1185995267 X:4940526-4940548 CTCCTGCAAGACCCTGGACTTGG + Intergenic
1192262126 X:69511697-69511719 TTCCTGCCAGACCATGGTATTGG - Intronic
1197784195 X:130184541-130184563 CTCAAACAAGAGCATGTTGTGGG - Exonic
1198113237 X:133521359-133521381 CTCCAGCAATACCAAGGGGTGGG - Intergenic
1199731893 X:150641884-150641906 CTCCAGTTAGACAATGGTATTGG - Intronic