ID: 989256302

View in Genome Browser
Species Human (GRCh38)
Location 5:39369294-39369316
Sequence CTCCAGCAAGACCATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989256302_989256306 12 Left 989256302 5:39369294-39369316 CCCACACCATGGTCTTGCTGGAG No data
Right 989256306 5:39369329-39369351 ATGATTTCAGTATGTGGTAGAGG 0: 1
1: 0
2: 1
3: 15
4: 191
989256302_989256305 6 Left 989256302 5:39369294-39369316 CCCACACCATGGTCTTGCTGGAG No data
Right 989256305 5:39369323-39369345 ACTTGTATGATTTCAGTATGTGG 0: 1
1: 0
2: 1
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989256302 Original CRISPR CTCCAGCAAGACCATGGTGT GGG (reversed) Intronic