ID: 989262672

View in Genome Browser
Species Human (GRCh38)
Location 5:39435917-39435939
Sequence ATAAGTTGGACAAGTTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989262672 Original CRISPR ATAAGTTGGACAAGTTTAGC TGG (reversed) Intronic
902182379 1:14698900-14698922 AGAAAGTGGACAAGTTTAGCTGG + Intronic
905060327 1:35134575-35134597 ATCAGTTGGACATGATCAGCAGG + Intergenic
905641900 1:39595721-39595743 ATAAGGTGGACAATTTTAGGTGG + Intergenic
905752158 1:40475654-40475676 ATAACTTGGACAATTTTGGCAGG - Intergenic
906307347 1:44727920-44727942 ATGAGGTGGAAATGTTTAGCTGG - Intergenic
906830402 1:49025267-49025289 ATTAGTGGGACAAGTTTAGTTGG - Intronic
907902593 1:58754690-58754712 ATCACTTTGACAAGTTTATCAGG - Intergenic
909223461 1:72990058-72990080 ATCAGTTGGACACGATTGGCAGG + Intergenic
909755435 1:79220147-79220169 AGAAGTTGGAACAGTTTAGAGGG + Intergenic
911006093 1:93226085-93226107 AAGAGTTGGACAAGTTTAGAAGG - Intronic
912296668 1:108476403-108476425 ATTAATTGGACAAGATCAGCAGG - Intergenic
913966768 1:143383271-143383293 ATCAGATGGACCAGCTTAGCGGG + Intergenic
914061145 1:144208878-144208900 ATCAGATGGACCAGCTTAGCGGG + Intergenic
914118005 1:144757491-144757513 ATCAGATGGACCAGCTTAGCGGG - Intergenic
916916798 1:169415937-169415959 ATTAGTTGGAGAAATTTATCCGG - Intronic
917237118 1:172905982-172906004 ATAAGCTGGAGATGTCTAGCAGG + Intergenic
917353526 1:174102872-174102894 ATAAGATGGTGAACTTTAGCCGG + Intergenic
918641061 1:186841825-186841847 TTAAGATGGACAGGTTTATCTGG + Intronic
919007152 1:191911965-191911987 AGAGGTTGGAAAAGTTTAGAGGG - Intergenic
919150189 1:193686531-193686553 AGTAATTGGACATGTTTAGCAGG - Intergenic
920908206 1:210190741-210190763 ATCAGTTGGACACGATCAGCAGG - Intergenic
921732780 1:218596045-218596067 ATCAGTCGGACAAGATTGGCAGG + Intergenic
922368719 1:224889074-224889096 ATTAGCTGGACATGATTAGCAGG - Intergenic
922906588 1:229177897-229177919 ATCAGTTGGACACGATTGGCAGG - Intergenic
922920014 1:229294183-229294205 TTAAGTTTGACATGTTTATCAGG + Intronic
923115896 1:230937491-230937513 ATAAACTGGACAAGTCTATCTGG + Intronic
923898975 1:238304793-238304815 AGAGGTTGGAAAAGTTTGGCGGG + Intergenic
1062875196 10:937635-937657 ATAAGTTTGTGAATTTTAGCCGG - Intergenic
1070475119 10:76822041-76822063 ATCAGTTGGACACGATTGGCAGG - Intergenic
1070996196 10:80785283-80785305 ATCAGGTGGACAAGGTTACCTGG + Intergenic
1072280450 10:93861077-93861099 AGAAGTTGGAAGAGTTTAGAGGG + Intergenic
1072940742 10:99761358-99761380 AAAAGTTGGAAGAGTTTAGAAGG - Intergenic
1073394898 10:103209522-103209544 ATAAGCTGGACATGATCAGCAGG - Intergenic
1076061993 10:127420216-127420238 ATAACTTGCACAACTTCAGCTGG - Intronic
1077678878 11:4221521-4221543 ATTAGTTGGACATGATCAGCAGG + Intergenic
1077688314 11:4318161-4318183 ATTAGTTGGACATGATCAGCAGG + Intergenic
1079928705 11:26530245-26530267 ATAACTTGTACAAGTTTACGTGG + Intronic
1080208626 11:29758845-29758867 ACAACTTTGACAGGTTTAGCTGG + Intergenic
1082673299 11:56061735-56061757 ATAAGTTTTACAAATATAGCTGG + Intergenic
1083011110 11:59400418-59400440 ATGGGTTGGACAAGCTTAGAAGG + Intergenic
1085958482 11:81430317-81430339 ATAATTTGTACTAGTTTAGTTGG - Intergenic
1086005214 11:82028688-82028710 ATTAGTTGGACATGATCAGCAGG - Intergenic
1087177158 11:95106441-95106463 AGAAGTTGGAGAAATTTGGCGGG + Intronic
1094770134 12:33647973-33647995 ATAAGTTAAAGAAGTTGAGCAGG - Intergenic
1105032449 12:132893337-132893359 ATCAGTTGGACATGATCAGCAGG - Intronic
1107765683 13:43731939-43731961 ATAAGTCGCACAAGTTTCACAGG + Intronic
1108212288 13:48150764-48150786 AGAAGTTGGAAAAGGTTGGCTGG + Intergenic
1108956880 13:56168915-56168937 ATAAGATTCACAACTTTAGCAGG - Intergenic
1110544855 13:76744850-76744872 AAAAGTTGGGCAATTTTGGCCGG + Intergenic
1116231556 14:42224728-42224750 ATAAGTCTGACAAATTTGGCAGG - Intergenic
1116275146 14:42823638-42823660 AGAAGTTGGAACAGTTTAGTGGG + Intergenic
1116942516 14:50804557-50804579 ATAATTTGGACAAGTCTTCCGGG - Intronic
1117957718 14:61135668-61135690 ATTAGTTGGACACGATCAGCAGG + Intergenic
1119248113 14:73130405-73130427 ATTAGCTGGACACGATTAGCAGG + Intergenic
1125167983 15:36732155-36732177 ATAAATTTGAGAAGTTTGGCAGG + Intronic
1128707695 15:69849847-69849869 AAAAGGTTGGCAAGTTTAGCTGG - Intergenic
1131776103 15:95800643-95800665 ATCAGTTGGCCATGTCTAGCTGG + Intergenic
1131869814 15:96751627-96751649 ATAAGTTGGGCAAGTTTGTGTGG - Intergenic
1133612857 16:7449675-7449697 GTCAGTTGGATAATTTTAGCTGG + Intronic
1134341982 16:13354812-13354834 ATCAGTTGGACACGATTGGCAGG + Intergenic
1138167671 16:54818258-54818280 AAAAGATGGACAATTTTGGCAGG - Intergenic
1139201283 16:64980188-64980210 ATAAATTGTACAAGTTGAACAGG + Intronic
1146468440 17:33105598-33105620 AGCAGTTGGACAAGTTTGGAGGG + Intronic
1147000854 17:37360789-37360811 ATCAGTTGGACAAATGTAGTGGG + Intronic
1149351911 17:55798004-55798026 AAAAGATGGAAAACTTTAGCTGG + Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1154934430 18:21037443-21037465 ATAAGTTTTAAAAATTTAGCAGG + Intronic
1155905113 18:31441356-31441378 ATAAGTTGTGCAAGTTTTACAGG + Intergenic
1159929386 18:74295771-74295793 ATTAGCTGGACATGATTAGCAGG - Intergenic
1160041852 18:75352717-75352739 AGAGGTTGGAACAGTTTAGCAGG + Intergenic
1163907378 19:20159000-20159022 ATCAGTTGGACACGATTGGCAGG - Intergenic
1164336062 19:24322565-24322587 ATTAGTGGGACCAGTTTAGTTGG - Intergenic
1202700552 1_KI270712v1_random:160766-160788 ATCAGATGGACCAGCTTAGCGGG + Intergenic
926413787 2:12629967-12629989 ATCAGTTGGACACGATTGGCAGG - Intergenic
928383125 2:30838409-30838431 ATGAGTTGGGCAGGATTAGCAGG + Intergenic
928827466 2:35439345-35439367 ATTAGTGGGACACGATTAGCAGG + Intergenic
930070692 2:47363639-47363661 ATAAGATGGACAAGGTATGCTGG - Intronic
930573479 2:53115802-53115824 ATAACTTGGACAATTCTAGAAGG + Intergenic
931625976 2:64255997-64256019 ATCAGTTGGACACGATTGGCAGG - Intergenic
931739832 2:65231931-65231953 ATGGGTTGGACAAGTTTGCCTGG + Intronic
933013284 2:77091840-77091862 ATCAGTTGGACACGATTGGCAGG - Intronic
934171479 2:89544239-89544261 ATCAGATGGACCAGCTTAGCGGG + Intergenic
934281788 2:91618557-91618579 ATCAGATGGACCAGCTTAGCGGG + Intergenic
936772177 2:115926859-115926881 ACAAGTTGGACAAATATAGGAGG + Intergenic
938737184 2:134196895-134196917 CTAAGTTGTACTAGTTTAACAGG + Intronic
940107545 2:150116070-150116092 ATCAGTTGGACACGATCAGCAGG - Intergenic
943215981 2:185036141-185036163 ATTAGTTGGACCATTTTATCAGG + Intergenic
943434048 2:187841165-187841187 ATAAGTTAGAATAGTTTATCTGG - Intergenic
943862439 2:192885422-192885444 ATAATTTTAACATGTTTAGCAGG + Intergenic
944253306 2:197599274-197599296 ATGTTTTGGACAATTTTAGCTGG + Intronic
1170165936 20:13360413-13360435 ATCAGTTGGACACGATTGGCAGG - Intergenic
1170718971 20:18858644-18858666 AGAAGTTGGAAGAGTTTAGAGGG + Intergenic
1173853634 20:46235230-46235252 ATAAGTAGGAGGAGTTGAGCTGG + Intronic
1180653514 22:17399121-17399143 CTGAGTTGGTCAAGTTCAGCAGG + Intronic
1181664317 22:24381513-24381535 ATGGGTTGGACTGGTTTAGCAGG + Intronic
1182725741 22:32443813-32443835 ATAAGCTGGGCAAGTTTACATGG - Intronic
950928836 3:16769353-16769375 ATTGGATGGACAAGTTGAGCCGG - Intergenic
951002635 3:17581432-17581454 ATAAGTTGGAGATGTCTATCTGG - Intronic
951762591 3:26162620-26162642 ATCAGTTGGACATGATTAGCAGG + Intergenic
955009358 3:54999044-54999066 ATTAGTTAAACAACTTTAGCTGG - Intronic
956709408 3:72026457-72026479 ATTAGTTGGACATGATCAGCAGG - Intergenic
960282677 3:115795745-115795767 ATCAGTTGGACACGATTGGCAGG + Intergenic
960786987 3:121384324-121384346 GGAAGTTGGACAAGTTTGGGAGG + Intronic
964840776 3:160991185-160991207 ACAGATTGGACAAGTTTGGCTGG + Intronic
966133676 3:176673810-176673832 ATAAGTTGGAGAAGGTTACATGG - Intergenic
966183862 3:177211037-177211059 CTAGGTAGGACAAGTTTAGTGGG - Intergenic
966804159 3:183793365-183793387 AGAAGTTGGTCAATTTTAACAGG - Intronic
969383237 4:6822183-6822205 GTCAGTTGGAAAAGTTCAGCTGG + Intronic
970087735 4:12367231-12367253 ATTAGTTGGACACGATCAGCAGG - Intergenic
970528303 4:16955682-16955704 AGAAGTTGGAAGAGTTTAGAGGG - Intergenic
970532930 4:17001128-17001150 ATCAGTTGGACACGATTGGCAGG - Intergenic
976696734 4:87925329-87925351 ATCAGTTGGACACGATTGGCAGG - Intergenic
979137402 4:117127245-117127267 AGAGGTTGGAAAAGTTTAGAGGG + Intergenic
979224885 4:118273439-118273461 AAAATTTGGACCAGTTTGGCTGG - Intergenic
979850113 4:125563878-125563900 ATCAGTTGGACACGATTGGCAGG + Intergenic
979894972 4:126147390-126147412 ATTAATTGGACACGTTCAGCAGG + Intergenic
979918541 4:126470503-126470525 GAAAGGTGGACAATTTTAGCTGG + Intergenic
980676665 4:136092860-136092882 AGAAGGTGGAAAAGTTTACCAGG - Intergenic
981191841 4:141873218-141873240 AGAAGTTGGAACAGTTTAGAAGG - Intergenic
981539913 4:145836212-145836234 ATCAGTTGGACACGATTGGCAGG - Intronic
982180287 4:152743579-152743601 ATCAGTTGGACACGATTGGCAGG + Intronic
987870685 5:23613465-23613487 AGAAGTTGGACAAGTTTGGAGGG + Intergenic
988602044 5:32649230-32649252 ATAATTTGGAAAAGTGTGGCCGG + Intergenic
989262672 5:39435917-39435939 ATAAGTTGGACAAGTTTAGCTGG - Intronic
995124974 5:108570719-108570741 ATTAGTTGGACACGATCAGCAGG + Intergenic
996574793 5:124968858-124968880 ATTAGTTGGACACGATCAGCAGG + Intergenic
998995580 5:147866750-147866772 ATCAGTTGGACACGATTGGCAGG - Intergenic
998996209 5:147871232-147871254 ATCAGTTGGACACGATTGGCAGG + Intronic
1008911858 6:56742753-56742775 ATAAGTTAAACAAGTTAGGCTGG - Intronic
1010099945 6:72092359-72092381 ATAAGTTGGAGAAGTTGACAGGG + Intronic
1012066349 6:94556189-94556211 ATCAGTTGGACACGATTGGCAGG + Intergenic
1015266937 6:131298913-131298935 ATCAGTTGGACACGATTGGCAGG - Intergenic
1015801186 6:137063571-137063593 ATTAGTTGGACACGATCAGCAGG + Intergenic
1016595349 6:145791740-145791762 AGAAGTTGGAAAAGTTTGGAGGG - Intergenic
1016756046 6:147688166-147688188 ATAAGATGCAGAATTTTAGCAGG - Intronic
1017153935 6:151306238-151306260 AAGAGTTGTACAAGTATAGCAGG - Intronic
1017574054 6:155781754-155781776 ATAAGTTGGATAAGGTTATTTGG + Intergenic
1026385390 7:69842323-69842345 ATAATTAGGACAAGTTTATCTGG - Intronic
1029357816 7:100065767-100065789 ATAATTGGGATATGTTTAGCAGG - Intronic
1031084260 7:117286817-117286839 GTAAGTTGGAAAAGTTTGACTGG + Intronic
1031727754 7:125261155-125261177 ATCAGTCGGACAAGATTGGCAGG + Intergenic
1033542354 7:142368711-142368733 AAAAGTTGGAAGAGTTTAGAGGG - Intergenic
1035214556 7:157355529-157355551 AGAAGTTGGACAAGGAGAGCTGG + Intronic
1037037279 8:14182509-14182531 ATGAGTTGGACAAGTCCAGCTGG - Intronic
1037622276 8:20575036-20575058 CCATTTTGGACAAGTTTAGCTGG + Intergenic
1038051447 8:23817462-23817484 ATCAGTTGAACAAATTTAGTTGG - Intergenic
1038280527 8:26160081-26160103 AGAAGTTGGAACAGTTTAGAGGG - Intergenic
1039194177 8:35012130-35012152 AAAAGTTTAACAAGATTAGCGGG - Intergenic
1041971243 8:63745741-63745763 ATAAGTAGGACAACTTCAGGCGG + Intergenic
1043023081 8:75029325-75029347 ATAGGCTGGACAAGTCCAGCAGG + Intronic
1047120346 8:121896428-121896450 AAAAGATGGACAAGTCTAGTAGG + Intergenic
1047856572 8:128917877-128917899 ATTAGTTGGACACGATCAGCAGG - Intergenic
1048668829 8:136694435-136694457 AAAAGTTGGAGTAGTTTAGAGGG + Intergenic
1050255516 9:3788643-3788665 AGAAGTTGGAACAGTTTGGCGGG + Intergenic
1051747460 9:20308523-20308545 AAAAGATGGACAAGGTTGGCTGG + Intergenic
1052356520 9:27510532-27510554 ATAGGTTAGACCAGTTTAACAGG + Intronic
1052540834 9:29810006-29810028 AGAAGTTGGACTAGTTTGGAGGG + Intergenic
1055151157 9:73002066-73002088 ATAAGTCGGATAGATTTAGCAGG - Intronic
1055170655 9:73254192-73254214 AGAAGTTGGAACAGTTTAGAGGG + Intergenic
1056522639 9:87414387-87414409 ATCAGTTGGACACGATTGGCAGG - Intergenic
1059582426 9:115566318-115566340 AGAGGTTGGAAAAGTTTAGAGGG + Intergenic
1059606512 9:115841449-115841471 ATCAGTTGGACACGATTGGCAGG + Intergenic
1059849218 9:118318463-118318485 ATAAGTTGGCAAAGTATATCAGG - Intergenic
1185680243 X:1882964-1882986 ATACGTTGAACAAGTTGACCTGG + Intergenic
1190461442 X:50680338-50680360 CTAAGTTGGACCAGTTGAGGAGG - Intronic
1191598547 X:62975112-62975134 AGAAGTTGGAAAAGTTTGGAGGG - Intergenic
1192040984 X:67621246-67621268 AGGAGTTGGACTAGTTTAGTGGG + Intronic
1192706341 X:73531139-73531161 ATTAGTTGGACATGATCAGCAGG - Intergenic
1193284465 X:79695833-79695855 CTAAGTTGGACAAGTTCTCCTGG + Intergenic
1196992479 X:121345246-121345268 ATCAGTTGGACACGATTGGCAGG + Intergenic
1198668020 X:139045907-139045929 ATAGGTTGGAAGAGTTTAGAGGG - Intronic
1198872715 X:141193123-141193145 AGAAGTTGGAACAGTTTAGAGGG + Intergenic