ID: 989264324

View in Genome Browser
Species Human (GRCh38)
Location 5:39455555-39455577
Sequence CAATAAATCCAGAGATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989264315_989264324 6 Left 989264315 5:39455526-39455548 CCCTTATCCCACATTCTTATTGT 0: 1
1: 0
2: 1
3: 57
4: 512
Right 989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG 0: 1
1: 0
2: 1
3: 14
4: 212
989264318_989264324 -2 Left 989264318 5:39455534-39455556 CCACATTCTTATTGTTTCCCCCA 0: 1
1: 2
2: 1
3: 26
4: 303
Right 989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG 0: 1
1: 0
2: 1
3: 14
4: 212
989264316_989264324 5 Left 989264316 5:39455527-39455549 CCTTATCCCACATTCTTATTGTT 0: 1
1: 0
2: 0
3: 31
4: 314
Right 989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG 0: 1
1: 0
2: 1
3: 14
4: 212
989264317_989264324 -1 Left 989264317 5:39455533-39455555 CCCACATTCTTATTGTTTCCCCC 0: 1
1: 1
2: 1
3: 14
4: 215
Right 989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG 0: 1
1: 0
2: 1
3: 14
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989264324 Original CRISPR CAATAAATCCAGAGATTGGA TGG Intronic
901714230 1:11140293-11140315 CAATTATTCCACAGATTGGGTGG + Intronic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
903528667 1:24012828-24012850 AAATAAAGGCAGAGATTGCAGGG - Intergenic
904452098 1:30620263-30620285 CAAAAAATACAGAAATTAGATGG - Intergenic
908919919 1:69176933-69176955 CAAAAATACAAGAGATTGGATGG - Intergenic
908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG + Intergenic
911296370 1:96121935-96121957 CAGTAAAACCAGAAATTCGATGG - Intergenic
913301050 1:117368627-117368649 GAATAAAACCATAGACTGGAGGG + Intronic
915810305 1:158902168-158902190 AAATAAATTCTGATATTGGAAGG - Intergenic
915999212 1:160598487-160598509 CAAAAAATACAGAAATTGGCTGG + Intergenic
916465335 1:165068673-165068695 CAAAAAAGCCAGATATTTGATGG - Intergenic
916592176 1:166203016-166203038 AAATAAAAGCAGAGATGGGAAGG - Intergenic
917280479 1:173374341-173374363 CAAGAAATCCATAGATGGGGAGG - Intergenic
919194721 1:194268589-194268611 CAATAAAACCAAAGAAAGGAAGG + Intergenic
920861886 1:209715704-209715726 AAATAAATCAAGAGAGGGGAAGG + Intronic
922376858 1:224977524-224977546 CAATAAATCAAGAGGAGGGAAGG + Intronic
923130368 1:231069653-231069675 CAAAAAATCAAGTGATTAGAGGG - Intergenic
923354012 1:233136044-233136066 CAATCCATCTTGAGATTGGAGGG + Intronic
924329807 1:242930319-242930341 CACTAAATACAGAGCTGGGAAGG + Intergenic
924714302 1:246558306-246558328 CAAAAAATCCAAAAATTGGTGGG - Intronic
1063729297 10:8677525-8677547 CAAGACATCCAGAGATAGGGAGG - Intergenic
1064053154 10:12075534-12075556 CAAAAAATACAAAAATTGGATGG - Intronic
1064280923 10:13950941-13950963 CAAAAAATACTGAGATTCGAAGG + Intronic
1065816110 10:29484211-29484233 AAATAAATCCTGAAATTCGAGGG + Intronic
1068317607 10:55367028-55367050 CCATAATCCCAGAGAATGGAGGG - Intronic
1071612337 10:87042867-87042889 CAAAAAATACACAGATTGGCCGG + Intergenic
1071807568 10:89141468-89141490 CAATAACCCCAGAGATTAGGGGG + Intergenic
1072322938 10:94268745-94268767 CAATTAATCCAGAGTGGGGAAGG - Intronic
1072788221 10:98299032-98299054 CCACCAATCCAGAGATTGGAAGG + Intergenic
1072968086 10:99992076-99992098 CAAAAAATCCAAAAATTGGGCGG + Intronic
1075493646 10:122898692-122898714 CAATAAACCCAGAAAGTGTAAGG + Intergenic
1076089493 10:127669663-127669685 CAATGAATCCAAAGATGAGAGGG - Intergenic
1076176749 10:128374080-128374102 TAAGAAATCCAGAGAATGGGTGG - Intergenic
1076201068 10:128558498-128558520 CAGTAATTCTAGAGATAGGAAGG - Intergenic
1083169902 11:60917245-60917267 CAATAAATCCAGAGCCATGAGGG - Intronic
1087382992 11:97431736-97431758 CAATAAATGCTGTGATAGGAAGG - Intergenic
1087491462 11:98832573-98832595 CAAAAATTCCACAGACTGGATGG - Intergenic
1088560894 11:111115121-111115143 CAAGAAATCTTGAGATTAGAAGG - Intergenic
1092184638 12:6470070-6470092 AAACAAATCCAGAGATTGTAGGG + Intronic
1092292112 12:7166602-7166624 CAATTTTTCCAGAGACTGGAGGG - Intergenic
1092785207 12:12020196-12020218 CAATAAATAAAGAGACAGGATGG - Intergenic
1092874395 12:12835519-12835541 CCATAACTCTAGAGATTGAAGGG + Intergenic
1093316672 12:17659966-17659988 CTATAAATCCAACGATTGGGAGG - Intergenic
1093661386 12:21761335-21761357 AAATGAATCCAAATATTGGAGGG + Intergenic
1093788238 12:23216731-23216753 CAATGAATCAAGACTTTGGATGG + Intergenic
1095491131 12:42734758-42734780 AAATCAATCCAGAGAGTGAAGGG - Intergenic
1096565737 12:52476948-52476970 CAAGGAATCCAAAGATTTGATGG - Intergenic
1096896138 12:54821982-54822004 AAATACATCCAGAGAGTGGGTGG - Intergenic
1097224244 12:57467741-57467763 CCATAAATCCAGGGGTTGGAGGG - Intronic
1098430348 12:70412398-70412420 CAAGAAATCCAGAGGTAGCATGG - Intronic
1101850136 12:108395078-108395100 TAATAAAACCAGAGATTGGAGGG - Intergenic
1105460212 13:20578529-20578551 CAACAAAACCAGAAATTTGAAGG - Intronic
1106679371 13:31994370-31994392 CAAAAATTCCACAGCTTGGAAGG + Intergenic
1107131086 13:36896292-36896314 CAATAAATCCAAAAATTAGCTGG - Intronic
1111846005 13:93509212-93509234 CAATAAATCTTTACATTGGAAGG - Intronic
1111853131 13:93601984-93602006 CTTTAAATCCTGAGATTGTAAGG + Intronic
1115170249 14:30496715-30496737 CTAAAAATCCACATATTGGATGG + Intergenic
1115230480 14:31154962-31154984 CAATGAATACAGAAATTGGTGGG + Intronic
1117529799 14:56649026-56649048 CTTCAAATCCAGAGAATGGAGGG - Exonic
1118774673 14:68966386-68966408 CTATAAACCGAGAAATTGGATGG - Intronic
1118792869 14:69111519-69111541 CAGAAAATAAAGAGATTGGAAGG + Intronic
1120129457 14:80787879-80787901 CAGTAAGTCCAGAGACAGGATGG + Intronic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1125158398 15:36615617-36615639 CACTAAATCCAGAAATCTGAAGG + Intronic
1125343312 15:38695672-38695694 CAAGTAATCCAGAGCTGGGATGG + Intergenic
1126389306 15:48128942-48128964 TAATAAATGCAGAGGTAGGAAGG - Intronic
1129311658 15:74716773-74716795 CAATAAATACAGAGGATGTAGGG - Intergenic
1130607120 15:85327956-85327978 CAATAAAGGCAGAGATAAGATGG - Intergenic
1131598409 15:93823097-93823119 GAATAAATGAAAAGATTGGAGGG - Intergenic
1131657570 15:94477482-94477504 CTATAAATCCAGAGGAAGGAGGG + Intronic
1133864019 16:9624929-9624951 AACTAAATGCAGAGATGGGAGGG + Intergenic
1135935178 16:26773886-26773908 CCAGAAATCCAGAGTTTGTATGG + Intergenic
1136486397 16:30574879-30574901 GAATGATACCAGAGATTGGAAGG - Intronic
1141283119 16:82646800-82646822 CAATTAAGCCAGAGAGAGGAAGG + Intronic
1150372617 17:64653607-64653629 CAAAAAATACAGAAATTGGTCGG - Intronic
1150532928 17:66004327-66004349 AAATAAATCCAAAGATTAGCTGG + Intronic
1150918464 17:69459755-69459777 CAAGAAATACATAGATTGCAAGG + Intronic
1156018253 18:32570407-32570429 AAATACCTCCAGTGATTGGAGGG - Intergenic
1156951017 18:42897921-42897943 CAAGAAAACCAAAGATTGTATGG + Intronic
1157966582 18:52215612-52215634 AAATAAATTCAGAGTTTGTATGG + Intergenic
1159057804 18:63483672-63483694 CAATGGAGGCAGAGATTGGAGGG - Intronic
1159429885 18:68337690-68337712 CAAAAAAACAATAGATTGGAGGG - Intergenic
1163350213 19:16772106-16772128 CTATAATTCCAGAGCTTTGAGGG + Intronic
1165066080 19:33229250-33229272 CTAAAAATGCAGAGATTGGCCGG + Intergenic
1165072923 19:33265873-33265895 CAAAAAATACAGAAATTGGCTGG - Intergenic
1165930409 19:39354670-39354692 GAGTAACTCCTGAGATTGGATGG + Intronic
926661189 2:15468946-15468968 AAATAAATACAGAAATTTGATGG - Intronic
930350287 2:50244525-50244547 CAGCAAATCAAGAGATAGGAAGG - Intronic
931323647 2:61196384-61196406 CAAAAAATACAGAAATTGGCCGG - Intronic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
934604700 2:95685611-95685633 CAAGAAATACATTGATTGGAGGG - Intergenic
935130950 2:100260548-100260570 CAATAAATCCAGGTCCTGGATGG - Intergenic
938508690 2:131915947-131915969 CAATTAATACAAAGATTGGAAGG + Intergenic
939637301 2:144597996-144598018 TAATAGAACCAGAGAATGGATGG + Intergenic
940074335 2:149723992-149724014 AAATATATCCAGAGATTACAAGG + Intergenic
940079458 2:149783885-149783907 CAATACATCCAGAAATTGTTTGG + Intergenic
941147521 2:161869267-161869289 CAATAAATTCAGATTTTGGAAGG - Intronic
943254339 2:185574669-185574691 CAAGAAATTCAGAGACTGGCAGG - Intergenic
943713761 2:191127069-191127091 CAAATCATCCAGAGACTGGATGG - Intronic
944999996 2:205338923-205338945 GAAAAAGTCCAGAGATTGGTGGG + Intronic
945459078 2:210083488-210083510 TAATAAATTCAGATATTGGCAGG - Intronic
946049376 2:216849321-216849343 CAATAAATCCTGAGTTAGTAGGG + Intergenic
948573498 2:238934144-238934166 CAATAAGTCTTGAAATTGGATGG - Intergenic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1173069328 20:39746624-39746646 CAGTAAATCTAGAGATCAGAAGG + Intergenic
1173069330 20:39746648-39746670 CAACAAAACTAGAGTTTGGAAGG + Intergenic
1176784801 21:13242592-13242614 CAATTAATACAAAGATTGGAAGG - Intergenic
1177600869 21:23312104-23312126 CAAAAACTCTACAGATTGGAAGG - Intergenic
1177982840 21:27936428-27936450 CAATTAATACAAAGATTGGAAGG - Intergenic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1179050508 21:37885104-37885126 CAGTCAATCCAGGGATAGGATGG - Intronic
1180151929 21:45952982-45953004 AAAGAAATGCAAAGATTGGAAGG - Intergenic
1183342312 22:37288248-37288270 CTAAAAATACAGAGATTGGCTGG + Intronic
1184543540 22:45148154-45148176 CAATAAATGCAGAGCTTAGAAGG - Intergenic
949181301 3:1134812-1134834 CATGAATTCCAGATATTGGAAGG + Intronic
949291308 3:2469717-2469739 CAATGGATCAAGAGAATGGAAGG - Intronic
954491818 3:50913615-50913637 CAACAATTCCAGTGGTTGGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956803401 3:72784804-72784826 TAATAAATCTACAGAGTGGAAGG - Intronic
957404217 3:79756139-79756161 CAATAAATCAAGAGATTTTGTGG - Intronic
957585472 3:82126747-82126769 CAATTAATCAGGAGTTTGGAAGG + Intergenic
960222265 3:115127685-115127707 CAAGAAATTCAGAGACTTGAAGG + Intronic
960611368 3:119557865-119557887 CAAAACACACAGAGATTGGAGGG + Exonic
962327669 3:134449437-134449459 CAGGAAACACAGAGATTGGAAGG - Intergenic
962539110 3:136360492-136360514 GAATAAATTGAGAGATTGGGAGG - Intronic
964472461 3:157069781-157069803 CAATAAATCTTGAGCTTGGGTGG - Intergenic
965532886 3:169792503-169792525 TAATTAACCCAGAGAATGGAAGG - Intergenic
965644555 3:170866651-170866673 CAATACATCCTGTGAATGGAAGG - Intronic
966451121 3:180063093-180063115 CAATAAGTCCAGACTTTGGGGGG + Intergenic
967082894 3:186066821-186066843 CAACAAATTGAGAGATTGGCAGG + Intronic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
971121760 4:23712348-23712370 CAATTTTTCCACAGATTGGAGGG - Intergenic
975074589 4:70189801-70189823 CAGAAAATCCAGAAATTGGGAGG + Intergenic
975183876 4:71378555-71378577 CATTAAATCCAGACATTGTTTGG - Intronic
975895204 4:79081129-79081151 CAATAGAACAAAAGATTGGAAGG - Intergenic
977084268 4:92574649-92574671 CCTAAAACCCAGAGATTGGAGGG - Intronic
977961962 4:103096700-103096722 CAAAAAATACAGAAATTGGCTGG - Intronic
978282721 4:107036597-107036619 CAACAACTCCAGCGGTTGGAGGG + Intronic
978993309 4:115114939-115114961 CAATAAATGCTGAGTTTTGAAGG - Intergenic
979134900 4:117098560-117098582 CTATAAATCCAGACTGTGGATGG + Intergenic
979208997 4:118077524-118077546 GCATAAAGCCAGTGATTGGAGGG - Intronic
980888710 4:138791076-138791098 CATTTAATCAAGAGATTGGCAGG - Intergenic
982056646 4:151556684-151556706 CCTTAAAACCAGAGATTGAAAGG + Intronic
982062727 4:151620943-151620965 AAACAAATGCAGAGAGTGGAGGG + Intronic
982404099 4:155001513-155001535 CATTTAATCCAAACATTGGAGGG - Intergenic
987396704 5:17431279-17431301 CAATAGATCAATAGATTGGTAGG - Intergenic
989160630 5:38387330-38387352 CAATAAATCAAGGGGTTGGCAGG - Intronic
989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG + Intronic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
991964547 5:72078171-72078193 AACCAAATACAGAGATTGGAGGG + Intergenic
993530280 5:89016288-89016310 CACAAAATCCAGAGATTGCAAGG - Intergenic
994370883 5:98965858-98965880 TAATAAATCCAGAGAGTTGCAGG - Intergenic
994445988 5:99875136-99875158 CAATGAATTAAGAGATAGGAAGG + Intergenic
994744256 5:103659192-103659214 AAATAAATACAGAGAATGGGAGG + Intergenic
994957723 5:106554800-106554822 CAAAAAATCAAGAGATTCAAAGG - Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
998073723 5:139219154-139219176 CAAGAAACCCAGAGATAGGTGGG - Intronic
1000331086 5:160205891-160205913 CTAGAATTCCAGAGATGGGAAGG - Intronic
1000739991 5:164956798-164956820 CAGTAAAACCAGAGTTTAGATGG + Intergenic
1001330635 5:170760035-170760057 GAACAAAACCAGAGATGGGAGGG + Intergenic
1001389027 5:171363643-171363665 AAATAAATACAGAGATAAGATGG + Intergenic
1003226319 6:4209103-4209125 CAGTAAATCCAAAGAGTGGTTGG - Intergenic
1003459646 6:6318395-6318417 TTATAAAACCAGAGATTGGCAGG + Intronic
1003940780 6:11023623-11023645 CAATAAATCCCCATATTGGTTGG - Intronic
1004485133 6:16059468-16059490 CAATAAATCAAGAGACTTAAAGG + Intergenic
1004782634 6:18928264-18928286 CAAGAAATACATAGAATGGAAGG - Intergenic
1008884115 6:56412727-56412749 TAATAAAACCAGAGACTGGTAGG + Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1013183857 6:107740513-107740535 CAATACATCCAGAGTTTGTTTGG + Intronic
1013748955 6:113378718-113378740 AAAAAAATCCTGAGATTGGTTGG + Intergenic
1014122166 6:117738161-117738183 TAATAATACCAGAGACTGGATGG - Intergenic
1014512631 6:122343171-122343193 AAATAAATGCAGACATTTGATGG + Intergenic
1015020049 6:128462506-128462528 AAATAGATCTAGAGAGTGGAGGG + Intronic
1015710539 6:136134424-136134446 CAGCAAATCCAGAGTTTTGAGGG - Intronic
1016716023 6:147230026-147230048 CAATAAAACCAGAAATAGAAGGG - Intronic
1017551126 6:155508730-155508752 AAATAAATCAAGAAATTGGATGG - Intergenic
1017754283 6:157516719-157516741 CAATAAAGCAAGAGACTTGAAGG + Intronic
1018418702 6:163623322-163623344 AAATAAATCCAAAAATCGGAAGG + Intergenic
1019847628 7:3522122-3522144 CAATAAAACCAAAGATAGTAAGG - Intronic
1021209107 7:17823165-17823187 AAATAAATTCAGAGAATTGAAGG - Intronic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1023352542 7:39334831-39334853 CAATAAATACAGAGTTAGGGAGG + Intronic
1023652555 7:42387277-42387299 CAACAGAGCCAGAGACTGGAGGG - Intergenic
1023744231 7:43307410-43307432 CCATACATACAGAGATTGGGAGG + Intronic
1026105726 7:67419319-67419341 CAAAAACTCCAGAGATTGGGAGG + Intergenic
1027828199 7:83143421-83143443 TAATACATCCAGAAATTGAATGG + Intronic
1029441372 7:100588592-100588614 CAATAAATCCAAGGAGTGGCTGG - Intronic
1030548658 7:110931282-110931304 CATTAAACCCTGAGATGGGAAGG + Intronic
1031431129 7:121670877-121670899 CACTAAATCATGAGATTGGATGG - Intergenic
1032117722 7:129130833-129130855 TAAAAACTCCAGAGATTGGCTGG + Intergenic
1033046124 7:137963572-137963594 CAATAAAAACAAAGATGGGAGGG - Intronic
1034809756 7:154121417-154121439 CAATAAAAACAGTAATTGGAAGG - Intronic
1035143109 7:156784354-156784376 GAATAGATCTAGAGAGTGGACGG + Intronic
1035660136 8:1341543-1341565 CAAAAAAATCAGAGATGGGAAGG + Intergenic
1036003011 8:4630395-4630417 CAATTAATTCAGAGATTCAAGGG - Intronic
1041224752 8:55687205-55687227 CAATAAATCCAGAGAAAGAAAGG + Intergenic
1041388726 8:57330407-57330429 CTTTAAATCCAGTGAATGGAGGG + Intergenic
1043613072 8:82090572-82090594 CTAGTAATCCAGAGATTTGATGG + Intergenic
1043613367 8:82093372-82093394 CTAGTAATCCAGAGATTTGATGG + Intergenic
1044517510 8:93156493-93156515 CAAGAAGTCCAGAGACTGGCAGG + Intronic
1045625878 8:104049540-104049562 CAATAAAACAAGAAATTAGAAGG + Intronic
1045990044 8:108296092-108296114 CAAGAAATCCAGATATAGGCAGG - Intronic
1048065203 8:130960642-130960664 CAATAAAAACAGAGCATGGATGG + Intronic
1050309680 9:4340110-4340132 GAATAGATCCAGAGATTCTAGGG - Intronic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052229257 9:26127828-26127850 CACTTAATCCAAACATTGGAGGG + Intergenic
1052584250 9:30404377-30404399 CACTAAATGCAGAGATGAGAGGG + Intergenic
1052679104 9:31665793-31665815 AAATAAATGTAGAGATTGGATGG - Intergenic
1055448877 9:76412150-76412172 CAATAATACCAGAGACAGGAGGG - Intergenic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1056114378 9:83427327-83427349 CAATAACCCAAGAGGTTGGAAGG + Intronic
1056222016 9:84459175-84459197 CAATAAATTGAGAGTTTTGATGG - Intergenic
1056951382 9:91043220-91043242 CCATAACTCCAGAGCATGGATGG - Intergenic
1056991591 9:91417230-91417252 CAATACATTCAGAGAGTAGAGGG - Intronic
1186540069 X:10391445-10391467 AAATAAACCCAGAAACTGGAAGG + Intergenic
1186564151 X:10644424-10644446 CAATAAAGACAGGGTTTGGAGGG - Intronic
1186709225 X:12175202-12175224 AAATACACCCAGAGAATGGAGGG + Intronic
1192625329 X:72721046-72721068 CATTAAATCCAGTGGTTTGAGGG + Intergenic
1195851505 X:109287237-109287259 CAATACTTCCAAAGAGTGGAAGG + Intergenic
1196615998 X:117768186-117768208 CAAGAATTCCAGAGACTGAAAGG + Intergenic
1197532777 X:127650832-127650854 CAAAAATTCCACAGATTGGGTGG + Intergenic
1197666636 X:129231273-129231295 AAACAAAACCAGAGATAGGATGG + Intergenic
1199037958 X:143076143-143076165 CACTGAATCTAGAGATAGGAGGG - Intergenic
1199450834 X:147977389-147977411 CAATAAATCTACAGATGGTAGGG - Intergenic
1199756053 X:150865957-150865979 CAATAAATACAAAAATTGGCTGG + Intronic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic
1200051935 X:153437508-153437530 CAATAAATACAAAAATTGGCAGG + Intergenic
1201227164 Y:11829437-11829459 CACTAAATACAGAGCTGGGAAGG + Intergenic