ID: 989264909

View in Genome Browser
Species Human (GRCh38)
Location 5:39462284-39462306
Sequence ATGTATGCACACATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989264909_989264913 9 Left 989264909 5:39462284-39462306 CCATGTTTCATGTGTGCATACAT 0: 1
1: 0
2: 2
3: 23
4: 314
Right 989264913 5:39462316-39462338 AATCATTTGTATATTTCTTGGGG No data
989264909_989264911 7 Left 989264909 5:39462284-39462306 CCATGTTTCATGTGTGCATACAT 0: 1
1: 0
2: 2
3: 23
4: 314
Right 989264911 5:39462314-39462336 CAAATCATTTGTATATTTCTTGG No data
989264909_989264914 14 Left 989264909 5:39462284-39462306 CCATGTTTCATGTGTGCATACAT 0: 1
1: 0
2: 2
3: 23
4: 314
Right 989264914 5:39462321-39462343 TTTGTATATTTCTTGGGGCTAGG No data
989264909_989264912 8 Left 989264909 5:39462284-39462306 CCATGTTTCATGTGTGCATACAT 0: 1
1: 0
2: 2
3: 23
4: 314
Right 989264912 5:39462315-39462337 AAATCATTTGTATATTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989264909 Original CRISPR ATGTATGCACACATGAAACA TGG (reversed) Intronic
903334358 1:22615002-22615024 TTGTATGCGGACATGAAACCCGG - Intergenic
903385159 1:22921258-22921280 ATTTATGACCACAGGAAACAGGG - Intergenic
904398361 1:30238920-30238942 ATGCATGCTCAGATGAAAAATGG - Intergenic
905361516 1:37423948-37423970 ATGAATGAGCACCTGAAACAAGG + Intergenic
909294402 1:73928613-73928635 ATGTATACACACACGTTACAAGG + Intergenic
910268982 1:85372178-85372200 ATGTATGAACATATGACAAAGGG - Intronic
912465132 1:109867197-109867219 ATGTAGTCACAAATGAACCAAGG - Intergenic
913930669 1:124960413-124960435 TTGAATGCACACATCAAAAACGG + Intergenic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916172820 1:162013647-162013669 ATGCAGGCACACATGCACCAGGG + Intronic
916387095 1:164286963-164286985 ATGAATGTACAAATAAAACATGG - Intergenic
916593685 1:166220783-166220805 ATGGAAGGACACAGGAAACATGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
921162687 1:212484308-212484330 ATGTACACACACATAATACATGG - Intergenic
924624917 1:245689467-245689489 ATGTTTGCACACCTGCCACAGGG + Intronic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
924862467 1:247937978-247938000 TTGTAGGCATACATGAAATATGG + Intronic
1063160359 10:3414116-3414138 ATGTGAGCACTCGTGAAACAGGG + Intergenic
1064633843 10:17344152-17344174 ATATATGCACAAATAAACCATGG + Intronic
1065812368 10:29453867-29453889 GTGTATGCTCACATTAAAAAAGG - Intergenic
1066929851 10:41744170-41744192 ATGAATGCACTCATCAAAAACGG - Intergenic
1066933055 10:41790858-41790880 ATGAATGCACACATCAAAAGTGG - Intergenic
1067459128 10:46444522-46444544 AGGGATGCAGACACGAAACAAGG + Intergenic
1067628068 10:47940108-47940130 AGGGATGCAGACACGAAACAAGG - Intergenic
1068824306 10:61416930-61416952 ATCTATGCACACACAAAATACGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1071596574 10:86932161-86932183 ATGTGTGCATACACGATACATGG - Exonic
1071895452 10:90061577-90061599 GTGTATGAACCCATGAAACCTGG + Intergenic
1071988529 10:91076518-91076540 TTGGAGGCACACATGAGACAGGG + Intergenic
1074706605 10:116138531-116138553 ATGAAGTCACACGTGAAACATGG - Intronic
1075595625 10:123727138-123727160 ATGCATGAACACATGAACCATGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076286774 10:129307106-129307128 AGTCATGCACACAAGAAACAAGG + Intergenic
1077964583 11:7115129-7115151 ATGTATGTATTCATGAAAAATGG - Intergenic
1078626937 11:12966604-12966626 AGGTATTTAAACATGAAACAAGG - Intergenic
1079676064 11:23228262-23228284 ATATATACACATTTGAAACAGGG - Intergenic
1080610248 11:33897926-33897948 AGGTACGCACACCTGGAACATGG - Intergenic
1080838060 11:35958871-35958893 ACGTCTGCACACGTGAATCAAGG - Intronic
1081078012 11:38699776-38699798 ATGGAGGCAGACATTAAACAAGG - Intergenic
1081330201 11:41792182-41792204 AGGTATGTACCCATGAAGCAGGG - Intergenic
1081998811 11:47381035-47381057 ATGAATGAACACATCAAGCAGGG - Intergenic
1082297580 11:50461053-50461075 ATGAATGCACACATCACATAGGG - Intergenic
1082301850 11:50515578-50515600 ATGAATGCACACATCAAAAGAGG + Intergenic
1082306426 11:50582312-50582334 ATGAATGCACACATCAGAAAGGG - Intergenic
1082309233 11:50626121-50626143 ATGAATGCACACATCACAAAGGG - Intergenic
1082312918 11:50676055-50676077 ATGAATGCACACATGCCAAATGG + Intergenic
1082572216 11:54757499-54757521 ATGAATGCACGCATCAAAAAGGG - Intergenic
1082576920 11:54818227-54818249 ATGAATGCACACATCACAAACGG + Intergenic
1082584270 11:54915399-54915421 ATTAATGCACACATCAAAAAGGG + Intergenic
1082584531 11:54919173-54919195 ATGAATGCACACATCATAAAGGG + Intergenic
1082590252 11:54998697-54998719 ATGAATGCACACATAACCCAGGG - Intergenic
1082601272 11:55158980-55159002 ATGAATGCACACATCACAAAAGG + Intergenic
1082603308 11:55189693-55189715 ATGAATGCACACATCACAAAAGG + Intergenic
1082934354 11:58640862-58640884 ATGTGTGCACACATGGACCCAGG + Intronic
1084759866 11:71263480-71263502 ATCTCTGGACACATGCAACAAGG + Intergenic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085373513 11:76035908-76035930 ATGTATTTACTCATGAGACAAGG - Intronic
1085968429 11:81557086-81557108 TTTTATTCTCACATGAAACAGGG + Intergenic
1086154746 11:83653376-83653398 ATATATGGACACAGGAGACAGGG - Intronic
1086349756 11:85933748-85933770 TTGTATGCACATAATAAACATGG + Intergenic
1086610220 11:88746747-88746769 ATATATTCACACATCAAAGATGG + Intronic
1087296641 11:96384718-96384740 ATGTTAGAAGACATGAAACAAGG - Exonic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1093450125 12:19305014-19305036 ATGTGTCCACACATGAAAAAAGG - Intronic
1094258188 12:28460035-28460057 ATGTATGCATCCTTGGAACATGG - Intronic
1095066382 12:37781310-37781332 ATGAATGCACACAACAAAAAGGG - Intergenic
1095071782 12:37860766-37860788 ATGAATGCACACATCACAGAGGG + Intergenic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1097371617 12:58788578-58788600 ATGTATGCACACATATACCATGG - Intronic
1097491327 12:60274103-60274125 ATATTTGAACAAATGAAACATGG + Intergenic
1098708844 12:73727823-73727845 AACTATTCACACATAAAACAAGG + Intergenic
1099127650 12:78784679-78784701 ATGTATGCACACATTTAAATAGG - Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100040663 12:90313340-90313362 CTGAATGCACACATTAAAGAAGG + Intergenic
1100539228 12:95542244-95542266 ATGTATGCACACATAACACAAGG - Intronic
1102382812 12:112482273-112482295 ATGTATGCAAACATGAGTAACGG - Intronic
1103131946 12:118476966-118476988 ATGTGTGCACACATAGAAAAGGG - Intergenic
1106281892 13:28281573-28281595 ATGTATACACACAGAAAATATGG + Intronic
1107274284 13:38659380-38659402 ATGGCAGCACAGATGAAACATGG - Intergenic
1107638589 13:42417896-42417918 ATGCCTTCACACATGAAAGAAGG - Intergenic
1109399730 13:61810039-61810061 ATGAATTCACACATGCAATAGGG + Intergenic
1109734924 13:66470333-66470355 ATGTATGCACACCTAACACATGG + Intronic
1109984190 13:69954830-69954852 ATATATGCATAAATGAAACAAGG + Intronic
1111999025 13:95193085-95193107 AATTAGGCAAACATGAAACAGGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113267571 13:108636051-108636073 GTGCATGCAGAAATGAAACAGGG - Intronic
1114582250 14:23772777-23772799 ATGCCTGAACACATGAAACTTGG - Intergenic
1115303591 14:31912594-31912616 ATGCAGGGACACAAGAAACAAGG - Intergenic
1116125482 14:40779073-40779095 ATGTATGGGCACATTAATCAAGG - Intergenic
1118105081 14:62649606-62649628 ATGTAGGCAGACATGGAAAAGGG + Intergenic
1118812239 14:69283823-69283845 ATGAATGAATACATGACACAGGG - Intronic
1119355266 14:74000806-74000828 ATGTAAGCAATCATGAAAAATGG + Intronic
1120423493 14:84316963-84316985 ATGTAGGAACACAGGAAACATGG + Intergenic
1123810140 15:23916555-23916577 ATGTATGCACATAACAAAAATGG - Intergenic
1125302944 15:38276567-38276589 CTGTTTGCTCACCTGAAACATGG - Intronic
1125860075 15:42990727-42990749 ATTTATGCAGTCATTAAACATGG - Intronic
1127620616 15:60730250-60730272 AGGTGTGCACACATGACACTCGG + Intronic
1127743327 15:61936908-61936930 GTGTGTGCACACAGTAAACAAGG - Intronic
1128106269 15:65047382-65047404 ATATATACACACATTAAAAATGG + Intronic
1130954394 15:88616735-88616757 ATGTATGGACACTTGAAGTAAGG - Intergenic
1131096815 15:89660799-89660821 ATGTAAGTACATATGATACAAGG + Intergenic
1131842258 15:96449998-96450020 AATTATGCCCACATGAAAGAGGG - Intergenic
1132171630 15:99663348-99663370 ATATATGCACACATTATATACGG + Intronic
1135983787 16:27168797-27168819 GTGTATGCATTCATGAAACCCGG - Intergenic
1136227678 16:28869953-28869975 GTGAATGAACACATGAATCATGG + Intronic
1136244307 16:28964671-28964693 ACATATTCACACATGAAACGTGG - Exonic
1136740540 16:32518987-32519009 ATGAATGCACACATCACAAAGGG + Intergenic
1136741349 16:32531786-32531808 ATGAATGCACACATCACAAAGGG + Intergenic
1137969627 16:52971534-52971556 ATGGAAACACCCATGAAACAAGG - Intergenic
1138841721 16:60516728-60516750 ATGTAAGGACACAGGAAACATGG + Intergenic
1139138872 16:64237076-64237098 ATGTAAGCACAAAGGAAACCTGG + Intergenic
1140021386 16:71242378-71242400 ATGTTTGCTCACATGAATGAAGG - Intergenic
1140131763 16:72168086-72168108 ATGTCTTCATTCATGAAACAAGG + Intronic
1140465163 16:75175324-75175346 ATGTAAGCCCCCATGGAACAAGG + Intergenic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140689901 16:77471910-77471932 ATATATGCACAGAAGAAAGAGGG + Intergenic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141357545 16:83362589-83362611 CTGTGTCCTCACATGAAACATGG - Intronic
1141440046 16:84024278-84024300 ATGTGTGCACCCATGTGACATGG - Intronic
1141495151 16:84404573-84404595 ATGAATGAATGCATGAAACATGG - Intronic
1141705030 16:85660090-85660112 TTGTAGGGACACATGACACAGGG - Intronic
1142270248 16:89085256-89085278 ATGTCAACACACAGGAAACACGG + Intergenic
1203028254 16_KI270728v1_random:543448-543470 ATGAATGCACACATCACAAAGGG - Intergenic
1203029066 16_KI270728v1_random:556247-556269 ATGAATGCACACATCACAAAGGG - Intergenic
1203042655 16_KI270728v1_random:778184-778206 ATGAATGCACACATCACAAAGGG + Intergenic
1203043467 16_KI270728v1_random:790983-791005 ATGAATGCACACATCACAAAGGG + Intergenic
1143358009 17:6345195-6345217 ATTTATGCTCCCATGAAACCAGG - Intergenic
1143504078 17:7354320-7354342 ATGCACGCACACATGAAGAAAGG - Exonic
1144452313 17:15391270-15391292 ATGTGAGCACCCAAGAAACAGGG + Intergenic
1144677212 17:17169353-17169375 ATGGATGCAGACAGGAAGCAGGG - Intronic
1145247688 17:21280322-21280344 ATGCACACACACATGACACAAGG - Intergenic
1147016179 17:37493360-37493382 AGGTATGCACACCTGACTCAGGG - Intronic
1147692529 17:42325379-42325401 CTGTATCTTCACATGAAACAGGG + Intronic
1151045378 17:70914167-70914189 ATGTATGCACAAATAAAGTAAGG - Intergenic
1153628081 18:7040758-7040780 ATGAATGGATATATGAAACATGG + Intronic
1155062272 18:22239166-22239188 ATGAATGCACTCATGAATGAAGG + Intergenic
1155468649 18:26167670-26167692 ATGTGTGCACACAAGAAGAAAGG + Intronic
1156809399 18:41228308-41228330 ATTTCTGCACATCTGAAACATGG + Intergenic
1158778730 18:60619918-60619940 ATATATGCACACAGGTATCAAGG - Intergenic
1158968450 18:62644121-62644143 ATGCATGCTCACCTGATACAGGG + Intergenic
1165635576 19:37336952-37336974 ATCTATTCACACATAGAACAAGG + Intronic
1166148587 19:40854035-40854057 ATGTGTGCACACATGATTTAGGG + Intronic
1166152726 19:40885816-40885838 ATGTGTGCACACATGATTTAGGG + Intronic
1166177450 19:41084827-41084849 ATGTGTGCACACATGATTTAGGG - Intergenic
1166497871 19:43317228-43317250 ATGAATGCACACACGAACAAAGG + Intergenic
927926467 2:27017126-27017148 ATGTTTGCTCAAAGGAAACAAGG + Intronic
928664333 2:33535885-33535907 CTGTATGCACACATACAATAGGG - Intronic
929043818 2:37771965-37771987 ATGTGAGGACCCATGAAACAGGG + Intergenic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930146599 2:48013544-48013566 ATATATGCAGACATGAAATCTGG + Intergenic
935395027 2:102598285-102598307 ATGTATGCAACCATGTAATAAGG - Intergenic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
935615619 2:105077556-105077578 ATGTATGCCTGCATGAAATAGGG - Intronic
937690691 2:124751445-124751467 AAGTATTCACACATGACACCAGG + Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
943083445 2:183283758-183283780 ATTTATGCACTCATAAAACTGGG + Intergenic
945598467 2:211826938-211826960 ATATATACACACATGCAAAAGGG - Intronic
945746339 2:213723559-213723581 ATGCAAGCACTCAAGAAACATGG + Intronic
945759030 2:213888566-213888588 ATGTAAGTACACATGAAAGTTGG + Intronic
946756163 2:222949930-222949952 ATGTATGCTCACAATAAAAAAGG - Intergenic
1169814767 20:9644988-9645010 ATATATGCATACATGAAAAATGG + Intronic
1170301293 20:14887123-14887145 ATGTATGCACACATACAGCCAGG - Intronic
1171764501 20:29250715-29250737 ATGAATGCACACATGACAGGGGG + Intergenic
1173260856 20:41434230-41434252 ATTTATGCAAACATTAATCAAGG + Intronic
1174141089 20:48414151-48414173 ATGCATGCACACATAAGATATGG + Intergenic
1175231394 20:57475690-57475712 AGGTATGGCCACGTGAAACAGGG - Intergenic
1175698463 20:61120508-61120530 CTCTATGCACACAAGAAACCAGG + Intergenic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176696838 21:9988310-9988332 ATTTATTGACACAGGAAACAAGG - Intergenic
1179441259 21:41395868-41395890 GTGTATGCACAAATTACACAAGG + Intronic
1181406741 22:22690326-22690348 ATGTAATCACACATCACACAGGG + Intergenic
1183952470 22:41359244-41359266 ATATATACACACTAGAAACAAGG - Exonic
951317167 3:21202490-21202512 ATGTAAGTACACAGAAAACATGG - Intergenic
953751656 3:45613254-45613276 ATAGAAGCACACATAAAACAAGG + Intronic
954433386 3:50483264-50483286 TTGCATGCACACAGGAACCAAGG + Intronic
955007776 3:54985958-54985980 ATGAATGGGCCCATGAAACAAGG + Intronic
956817756 3:72923940-72923962 ATTTATGCAGACATGAATGAAGG + Intronic
958547985 3:95580302-95580324 ATTAATGTACACATGAAATATGG - Intergenic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
959979540 3:112500021-112500043 ATGTATCCACAGATTAAAGACGG - Intergenic
961102596 3:124214184-124214206 CTGTATGCACAATTGAGACATGG + Intronic
962262511 3:133922578-133922600 ATGTATACACACACACAACATGG - Intergenic
962577492 3:136768265-136768287 ATCTCTGCACACATGCACCAAGG + Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
965238999 3:166169407-166169429 ATGCATGTACAAAAGAAACATGG + Intergenic
967428720 3:189357360-189357382 GTGTATGAACACATGACATATGG + Intergenic
967531169 3:190550086-190550108 AAGCAGGCACCCATGAAACAGGG + Intronic
967936485 3:194732128-194732150 AAGTATGCAAATATGAGACATGG + Intergenic
969962913 4:10964315-10964337 ATGTGTGCACACATGAACACAGG + Intergenic
970072710 4:12179636-12179658 ATGTATGCAATGATGTAACAAGG + Intergenic
970111217 4:12639974-12639996 ATGTGGGCACCCATGAAAGAAGG - Intergenic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
971151506 4:24037610-24037632 ATGAATGCAAACATTCAACAAGG - Intergenic
971632197 4:29007414-29007436 ATTTATGCACACATTGAAAAGGG - Intergenic
972128194 4:35796992-35797014 AAGAAGACACACATGAAACAAGG + Intergenic
973027071 4:45285251-45285273 ATGTATGCATTTATGGAACATGG - Intergenic
973107949 4:46363141-46363163 AATTATGCATACATGAGACATGG + Intronic
976278403 4:83302058-83302080 ATGTATAGACACATGCAACAGGG + Intronic
977673724 4:99725142-99725164 ATGTATACACACATTGAAAAAGG - Intergenic
978259367 4:106735666-106735688 ATGTATGCACCTAGTAAACAAGG + Intergenic
979165450 4:117524020-117524042 ATGAATTCACACATCCAACAAGG - Intergenic
980369438 4:131848497-131848519 ATTTATTGACACAGGAAACAAGG - Intergenic
981649281 4:147037726-147037748 ATGGATGTGCAGATGAAACAGGG + Intergenic
983674082 4:170271454-170271476 ATTTATGGAAACATGAAATAAGG - Intergenic
983842857 4:172479349-172479371 ATATATGCACACATACACCATGG + Intronic
984967314 4:185150909-185150931 AAGTATAAACACATAAAACAAGG + Intergenic
985191588 4:187380479-187380501 ATATAAGCAAACATGACACACGG - Intergenic
985198897 4:187463245-187463267 ATGTGTGCCCACATGGCACAAGG - Intergenic
985230673 4:187812844-187812866 ATGTGTGCCCACTTGAAACACGG + Intergenic
985339329 4:188932154-188932176 ATGGATGCAAACATGAAATTTGG + Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986998862 5:13638378-13638400 ATGTCTGCACATTTGAGACAGGG + Intergenic
988050140 5:26017147-26017169 ATGTTGGTATACATGAAACATGG - Intergenic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
989841330 5:46075442-46075464 ATGAATGCACACATCAAAACTGG - Intergenic
989848582 5:46178072-46178094 ATGAATGCACACAACACACATGG + Intergenic
989852518 5:46232291-46232313 GTGAATGCACACATCACACAGGG - Intergenic
993611513 5:90060093-90060115 ATGAATGAACACATTAAACATGG - Intergenic
993690357 5:90992924-90992946 ATGTATGCACACTGGATAAAAGG - Intronic
996103398 5:119469662-119469684 ATGTAGGAACAAAAGAAACATGG - Intronic
996355205 5:122588076-122588098 ATTTATGCCCATGTGAAACATGG - Intergenic
996840880 5:127846314-127846336 ATGAATGAATACATGAAACAAGG + Intergenic
996889179 5:128397114-128397136 ATGTATGCACACATAATTAAAGG + Intronic
997437649 5:133886504-133886526 ATGTATGTATATATAAAACAAGG - Intergenic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
998910685 5:146956824-146956846 ATGTAAGGACACGTGAAAGATGG - Intronic
1000251458 5:159499535-159499557 CTGTATGCACACGTGGAAAATGG + Intergenic
1002345653 5:178546178-178546200 AGCCATGCACACATGAAATATGG + Intronic
1002567851 5:180122113-180122135 ACATAAGCACACATAAAACAAGG + Intronic
1002797904 6:490298-490320 AAGTGTGCACACATCCAACATGG + Intronic
1002867889 6:1139302-1139324 ATGTAATGACACATGAGACATGG + Intergenic
1003499224 6:6690487-6690509 ATCTGTGCACTCAGGAAACAGGG - Intergenic
1005627268 6:27674835-27674857 TTGTATGCACACAAGAAAAAAGG + Intergenic
1006972738 6:38063489-38063511 GTGTATGCAAACATGTATCAGGG - Intronic
1007804291 6:44427860-44427882 ATGTATGGAAACCTAAAACAAGG + Intronic
1007820656 6:44558392-44558414 CTGTATGTGCACATGAGACAAGG - Intergenic
1009064519 6:58442511-58442533 ATGAATGCACACATCACAAATGG - Intergenic
1009260668 6:61482523-61482545 ATGAATGCACACATCACAAAGGG + Intergenic
1009682667 6:66919030-66919052 ATGTATACACACATAAAATCTGG + Intergenic
1009725458 6:67531540-67531562 CAGGATGCACCCATGAAACAGGG + Intergenic
1009830598 6:68927150-68927172 ATGTATGTACACATGGTACATGG - Intronic
1010175972 6:73028333-73028355 ATGTAAGCACGGATGAAAAAGGG + Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1011725128 6:90203492-90203514 ATGTATGAACACTGGAAAGATGG + Intronic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1012801739 6:103838703-103838725 AACTATGCAAACATGAAAGAAGG + Intergenic
1013199804 6:107882493-107882515 TTATATACACCCATGAAACAAGG + Intronic
1013839168 6:114369691-114369713 TTGTATGAACTCATGAAATATGG + Intergenic
1014708689 6:124780430-124780452 GTGAATGCCTACATGAAACATGG - Intronic
1014909415 6:127072366-127072388 CTTAATGCACACATGAAAGAAGG + Intergenic
1015568050 6:134594219-134594241 CTGTCTGCCCACATGACACACGG - Intergenic
1021399119 7:20188946-20188968 ATGAATTCACACAAGAAACAAGG - Intronic
1022267054 7:28767220-28767242 ATAAATGCATACATGGAACAGGG - Intronic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1024159520 7:46660009-46660031 ATGTATACACATATGATACAGGG - Intergenic
1024516516 7:50263838-50263860 ATGTGTGCAGACATGGAACATGG + Intergenic
1024811515 7:53217875-53217897 TTGTATGCACATATGAGAGACGG + Intergenic
1025530429 7:61874404-61874426 ATGAATGCACACATCACAAAGGG + Intergenic
1025530720 7:61879153-61879175 ATGAATGCCCACATCAAAAAGGG + Intergenic
1025531184 7:61886365-61886387 ATGAATGCACACATCACAAAGGG + Intergenic
1025584208 7:62761528-62761550 ATGAATGCACACATCACAGAGGG + Intergenic
1025587100 7:62804247-62804269 ATGAATGCACACATCACAAAGGG + Intergenic
1025587832 7:62815034-62815056 ATGAATGTACACATCAAAAATGG + Intergenic
1025597310 7:62947005-62947027 ATGAATGCAAACATCAAAAAAGG - Intergenic
1025598452 7:62962682-62962704 ATTTATGCACACATCACATAGGG - Intergenic
1025923683 7:65938931-65938953 ATGGATGCAGCCATGAATCAGGG + Intronic
1026705358 7:72686787-72686809 ATGTATGCATGCATGGAATAGGG + Intronic
1029209903 7:98898664-98898686 ATATAAGGACTCATGAAACAAGG - Intronic
1029250598 7:99233450-99233472 ATGTATCCACAAGTGAGACAGGG + Intergenic
1030960468 7:115914216-115914238 ATGTTTGCACACAGAAAAGAAGG + Intergenic
1031283748 7:119839102-119839124 ATGTATACACACAGGTCACAGGG + Intergenic
1031324914 7:120383640-120383662 ATGTATGTACACATTGAACGTGG - Intronic
1031349373 7:120710259-120710281 ATGTTTGCACACCAGGAACAAGG + Intronic
1031498310 7:122479483-122479505 AAGTATGTATACATAAAACATGG - Intronic
1032506623 7:132439953-132439975 ATGTGTGCACATGTGAAATAAGG - Intronic
1033137208 7:138795455-138795477 AGGTATGCAAACATGTAAGATGG - Intronic
1033870889 7:145752175-145752197 ATGTATGCACCCATGAAGCAGGG + Intergenic
1034026142 7:147707190-147707212 ATGTAAGGACAAAAGAAACATGG - Intronic
1034391302 7:150789749-150789771 ATGTGTGGAAACATGAGACACGG + Intergenic
1035486738 7:159231925-159231947 GTGGATGGACACATGTAACAGGG - Intergenic
1035902127 8:3468367-3468389 ATGTTTGCTCACATAAAAGAAGG + Intronic
1036054564 8:5237241-5237263 ATTTATACACATATGAAATAGGG + Intergenic
1036089786 8:5653143-5653165 CTGTATCCCCACCTGAAACATGG + Intergenic
1036692011 8:10950066-10950088 ATGCATGCACACGTGACACATGG + Intronic
1036998938 8:13694916-13694938 ATGTATGGACACAAGAAATGGGG - Intergenic
1037099854 8:15031969-15031991 GTGTATGCAAAAATGAAACTGGG - Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1039899660 8:41742261-41742283 ATGTATGAATACAGGAGACACGG + Intronic
1040282201 8:46064199-46064221 CTGAATGCACACATCAAAAAGGG - Intergenic
1041232000 8:55762489-55762511 ATGCATGCAAACAGGTAACAGGG + Intronic
1041789197 8:61673097-61673119 CTGTATCCAGACATGAAAGAGGG - Intronic
1041935025 8:63324311-63324333 TGGTATGCACCCATGAAGCAGGG - Intergenic
1042429087 8:68683560-68683582 ATATATACACATTTGAAACATGG + Intronic
1043094903 8:75955344-75955366 ATATATGCACAGATGATCCATGG - Intergenic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043326289 8:79055907-79055929 GTGAATGCAGACATGAAACTTGG - Intergenic
1043400151 8:79876684-79876706 ATGTATGCACACAAAAGACCAGG + Intergenic
1045630528 8:104115780-104115802 ATGTATGCACCCATTAAAGGGGG + Intronic
1046069255 8:109230920-109230942 AAGTATGCAGACAAGAAACATGG - Intergenic
1046928546 8:119820259-119820281 ATGTACTCAAACATAAAACAAGG + Intronic
1047644164 8:126852119-126852141 AAGTAAGGAAACATGAAACAAGG - Intergenic
1047856953 8:128921089-128921111 GTGTATGTTCACATGAAAAACGG + Intergenic
1048361330 8:133699627-133699649 ATGAAGACACACATGAAAGACGG + Intergenic
1049132507 8:140860257-140860279 ATGTATGCATACATGTACAAGGG - Intronic
1050784124 9:9377718-9377740 ATGTTGGCACAGATGAAACAAGG + Intronic
1050977078 9:11952343-11952365 ATGTATACACTCACGAAGCAAGG - Intergenic
1050989093 9:12124270-12124292 CTGTATTCATCCATGAAACATGG - Intergenic
1051141341 9:13982258-13982280 ATATATGCCTATATGAAACAAGG + Intergenic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1051493495 9:17693225-17693247 ATGTTTGGACACATGGATCAGGG + Intronic
1052236648 9:26219026-26219048 ATGGATGGACACATGAAAGAGGG + Intergenic
1052270379 9:26622291-26622313 ATTTATGCAGACAACAAACATGG + Intergenic
1052527395 9:29636423-29636445 ATCTATAAACACATGAAACTCGG + Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1054314924 9:63572394-63572416 ATTTATTGACACAGGAAACAAGG - Intergenic
1054363520 9:64204579-64204601 ATGAATGCACACATCACAAAGGG + Intergenic
1054991695 9:71335154-71335176 AAGTTTGCAGGCATGAAACATGG + Intronic
1057572225 9:96213354-96213376 ATATATGCAGACATGAAGCCAGG + Intergenic
1058193397 9:101945261-101945283 ATGTATCCACAACTGACACATGG + Intergenic
1059073251 9:111162391-111162413 ATGTATTCACACTTAAGACATGG + Intergenic
1203394170 Un_KI270512v1:9032-9054 ATGAATGCAAACATCAAAAAGGG + Intergenic
1203398964 Un_KI270519v1:62107-62129 ATGAATGCACACATCACAAAAGG - Intergenic
1185842438 X:3404641-3404663 ATGTATGCATACATGGGCCAAGG + Intergenic
1186135903 X:6520568-6520590 ATATATGTACATATGCAACATGG + Intergenic
1186879129 X:13847161-13847183 ATGTTTGCACACATATAAGATGG - Intronic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1191264971 X:58379080-58379102 ATGAATGCACACATCACAAATGG + Intergenic
1191268407 X:58428793-58428815 ATGAATGCACACATCACAAAGGG + Intergenic
1191574526 X:62683249-62683271 ATGAATGCACACATCACAAAAGG - Intergenic
1192654633 X:72980345-72980367 ATGAATGGACAAATGAAATATGG + Intergenic
1195926385 X:110029894-110029916 ATGAAAGAACACCTGAAACAAGG - Intronic
1197618058 X:128716221-128716243 ATATATGCACACATATAACTAGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG + Intergenic
1201233002 Y:11883625-11883647 ATGTATGCAAACATGGTCCAAGG - Intergenic