ID: 989265129

View in Genome Browser
Species Human (GRCh38)
Location 5:39464629-39464651
Sequence GTTTTTATCTTAAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989265129_989265132 2 Left 989265129 5:39464629-39464651 CCCTTTGTCCTTAAGATAAAAAC No data
Right 989265132 5:39464654-39464676 GACTCTTCAAGTGATCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989265129 Original CRISPR GTTTTTATCTTAAGGACAAA GGG (reversed) Intergenic
No off target data available for this crispr