ID: 989267909

View in Genome Browser
Species Human (GRCh38)
Location 5:39499029-39499051
Sequence TGTAAGAGTAGAGCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989267906_989267909 0 Left 989267906 5:39499006-39499028 CCCAATGTATTAAAATTTAAAAA No data
Right 989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG No data
989267907_989267909 -1 Left 989267907 5:39499007-39499029 CCAATGTATTAAAATTTAAAAAT No data
Right 989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989267909 Original CRISPR TGTAAGAGTAGAGCACAGGC AGG Intergenic
No off target data available for this crispr