ID: 989271552

View in Genome Browser
Species Human (GRCh38)
Location 5:39539534-39539556
Sequence ACGTTGTGTTTCTTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989271552_989271556 28 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271556 5:39539585-39539607 GGTAAGGAAAAACTTAAAACAGG No data
989271552_989271557 29 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271557 5:39539586-39539608 GTAAGGAAAAACTTAAAACAGGG No data
989271552_989271558 30 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271558 5:39539587-39539609 TAAGGAAAAACTTAAAACAGGGG No data
989271552_989271554 7 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271554 5:39539564-39539586 TGATAATGAGAAAACTGTAGTGG No data
989271552_989271555 12 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271555 5:39539569-39539591 ATGAGAAAACTGTAGTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989271552 Original CRISPR ACGTTGTGTTTCTTTCAGTG TGG (reversed) Intergenic
No off target data available for this crispr