ID: 989271554

View in Genome Browser
Species Human (GRCh38)
Location 5:39539564-39539586
Sequence TGATAATGAGAAAACTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989271552_989271554 7 Left 989271552 5:39539534-39539556 CCACACTGAAAGAAACACAACGT No data
Right 989271554 5:39539564-39539586 TGATAATGAGAAAACTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989271554 Original CRISPR TGATAATGAGAAAACTGTAG TGG Intergenic
No off target data available for this crispr