ID: 989271790

View in Genome Browser
Species Human (GRCh38)
Location 5:39541968-39541990
Sequence TTCGATCTTAGAATAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989271790_989271793 4 Left 989271790 5:39541968-39541990 CCTCCATTTATTCTAAGATCGAA No data
Right 989271793 5:39541995-39542017 TCCTTGATTCAGGATGACAACGG No data
989271790_989271792 -6 Left 989271790 5:39541968-39541990 CCTCCATTTATTCTAAGATCGAA No data
Right 989271792 5:39541985-39542007 ATCGAAATTATCCTTGATTCAGG No data
989271790_989271795 5 Left 989271790 5:39541968-39541990 CCTCCATTTATTCTAAGATCGAA No data
Right 989271795 5:39541996-39542018 CCTTGATTCAGGATGACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989271790 Original CRISPR TTCGATCTTAGAATAAATGG AGG (reversed) Intergenic
No off target data available for this crispr