ID: 989285249

View in Genome Browser
Species Human (GRCh38)
Location 5:39691863-39691885
Sequence CTGTAGCATCAGAAGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989285249_989285256 4 Left 989285249 5:39691863-39691885 CCACTAGGCTTCTGATGCTACAG No data
Right 989285256 5:39691890-39691912 GTCTACTGGAGCTAACTTTGGGG No data
989285249_989285255 3 Left 989285249 5:39691863-39691885 CCACTAGGCTTCTGATGCTACAG No data
Right 989285255 5:39691889-39691911 GGTCTACTGGAGCTAACTTTGGG No data
989285249_989285257 24 Left 989285249 5:39691863-39691885 CCACTAGGCTTCTGATGCTACAG No data
Right 989285257 5:39691910-39691932 GGGCCACAACCAGTTGTCACAGG No data
989285249_989285254 2 Left 989285249 5:39691863-39691885 CCACTAGGCTTCTGATGCTACAG No data
Right 989285254 5:39691888-39691910 CGGTCTACTGGAGCTAACTTTGG No data
989285249_989285251 -10 Left 989285249 5:39691863-39691885 CCACTAGGCTTCTGATGCTACAG No data
Right 989285251 5:39691876-39691898 GATGCTACAGCCCGGTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989285249 Original CRISPR CTGTAGCATCAGAAGCCTAG TGG (reversed) Intergenic
No off target data available for this crispr