ID: 989289900

View in Genome Browser
Species Human (GRCh38)
Location 5:39750989-39751011
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989289900_989289902 17 Left 989289900 5:39750989-39751011 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 989289902 5:39751029-39751051 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989289900 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr