ID: 989295553

View in Genome Browser
Species Human (GRCh38)
Location 5:39821623-39821645
Sequence CTGTTTGTGACTAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989295548_989295553 9 Left 989295548 5:39821591-39821613 CCGATTCATCTATAAGCTCTCCC No data
Right 989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989295553 Original CRISPR CTGTTTGTGACTAGGGAAGA TGG Intergenic
No off target data available for this crispr