ID: 989296550

View in Genome Browser
Species Human (GRCh38)
Location 5:39834281-39834303
Sequence TTTCCCACCCTCTTTTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989296549_989296550 -9 Left 989296549 5:39834267-39834289 CCTGAATATATGTATTTCCCACC No data
Right 989296550 5:39834281-39834303 TTTCCCACCCTCTTTTGTATTGG No data
989296547_989296550 26 Left 989296547 5:39834232-39834254 CCTGAGTAATTGAAGAAGATGGT No data
Right 989296550 5:39834281-39834303 TTTCCCACCCTCTTTTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989296550 Original CRISPR TTTCCCACCCTCTTTTGTAT TGG Intergenic
No off target data available for this crispr