ID: 989297899

View in Genome Browser
Species Human (GRCh38)
Location 5:39851132-39851154
Sequence CTTTATATGCTATAGACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989297899_989297906 12 Left 989297899 5:39851132-39851154 CCCCCCGTCTATAGCATATAAAG No data
Right 989297906 5:39851167-39851189 GTTATACTGGCTTAAACCATGGG No data
989297899_989297905 11 Left 989297899 5:39851132-39851154 CCCCCCGTCTATAGCATATAAAG No data
Right 989297905 5:39851166-39851188 AGTTATACTGGCTTAAACCATGG No data
989297899_989297904 -1 Left 989297899 5:39851132-39851154 CCCCCCGTCTATAGCATATAAAG No data
Right 989297904 5:39851154-39851176 GAACTGCAGAAAAGTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989297899 Original CRISPR CTTTATATGCTATAGACGGG GGG (reversed) Intergenic
No off target data available for this crispr