ID: 989298114

View in Genome Browser
Species Human (GRCh38)
Location 5:39853648-39853670
Sequence TATCTCCTCTTTACAGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989298114_989298120 18 Left 989298114 5:39853648-39853670 CCACCGGCTGTAAAGAGGAGATA No data
Right 989298120 5:39853689-39853711 GAAAGTGGACTTTTTAAGGTAGG No data
989298114_989298119 14 Left 989298114 5:39853648-39853670 CCACCGGCTGTAAAGAGGAGATA No data
Right 989298119 5:39853685-39853707 AGCAGAAAGTGGACTTTTTAAGG No data
989298114_989298117 -10 Left 989298114 5:39853648-39853670 CCACCGGCTGTAAAGAGGAGATA No data
Right 989298117 5:39853661-39853683 AGAGGAGATAAGATATAGGATGG No data
989298114_989298118 3 Left 989298114 5:39853648-39853670 CCACCGGCTGTAAAGAGGAGATA No data
Right 989298118 5:39853674-39853696 TATAGGATGGAAGCAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989298114 Original CRISPR TATCTCCTCTTTACAGCCGG TGG (reversed) Intergenic
No off target data available for this crispr