ID: 989305276

View in Genome Browser
Species Human (GRCh38)
Location 5:39947978-39948000
Sequence ACTTCCAGTCACACACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989305276_989305280 17 Left 989305276 5:39947978-39948000 CCCTCCAGTGTGTGACTGGAAGT No data
Right 989305280 5:39948018-39948040 TAGTGGCCATATATGCACACTGG No data
989305276_989305279 0 Left 989305276 5:39947978-39948000 CCCTCCAGTGTGTGACTGGAAGT No data
Right 989305279 5:39948001-39948023 CTCTTTAACAGTTAAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989305276 Original CRISPR ACTTCCAGTCACACACTGGA GGG (reversed) Intergenic
No off target data available for this crispr