ID: 989307502

View in Genome Browser
Species Human (GRCh38)
Location 5:39974614-39974636
Sequence CACAGCTCTTGGCCTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989307502_989307506 13 Left 989307502 5:39974614-39974636 CCAGTTATAGGCCAAGAGCTGTG No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data
989307502_989307505 9 Left 989307502 5:39974614-39974636 CCAGTTATAGGCCAAGAGCTGTG No data
Right 989307505 5:39974646-39974668 GACTAGCTATCTGAAGAAGATGG No data
989307502_989307507 14 Left 989307502 5:39974614-39974636 CCAGTTATAGGCCAAGAGCTGTG No data
Right 989307507 5:39974651-39974673 GCTATCTGAAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989307502 Original CRISPR CACAGCTCTTGGCCTATAAC TGG (reversed) Intergenic
No off target data available for this crispr