ID: 989307506

View in Genome Browser
Species Human (GRCh38)
Location 5:39974650-39974672
Sequence AGCTATCTGAAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989307499_989307506 23 Left 989307499 5:39974604-39974626 CCACCAAAGCCCAGTTATAGGCC No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data
989307502_989307506 13 Left 989307502 5:39974614-39974636 CCAGTTATAGGCCAAGAGCTGTG No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data
989307501_989307506 14 Left 989307501 5:39974613-39974635 CCCAGTTATAGGCCAAGAGCTGT No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data
989307500_989307506 20 Left 989307500 5:39974607-39974629 CCAAAGCCCAGTTATAGGCCAAG No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data
989307504_989307506 2 Left 989307504 5:39974625-39974647 CCAAGAGCTGTGTCAAAAGGAGA No data
Right 989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989307506 Original CRISPR AGCTATCTGAAGAAGATGGC AGG Intergenic
No off target data available for this crispr