ID: 989311324

View in Genome Browser
Species Human (GRCh38)
Location 5:40022121-40022143
Sequence AGGCATGTCAATGCAAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989311321_989311324 4 Left 989311321 5:40022094-40022116 CCCACTTTCAATTGCATGCAAAC 0: 2
1: 2
2: 45
3: 193
4: 393
Right 989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG No data
989311322_989311324 3 Left 989311322 5:40022095-40022117 CCACTTTCAATTGCATGCAAACT 0: 2
1: 1
2: 43
3: 161
4: 417
Right 989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989311324 Original CRISPR AGGCATGTCAATGCAAATTT AGG Intergenic
No off target data available for this crispr