ID: 989319073

View in Genome Browser
Species Human (GRCh38)
Location 5:40114038-40114060
Sequence CAGGAATGAGTTCTCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989319069_989319073 -4 Left 989319069 5:40114019-40114041 CCGCCAGAAGCTAAAGAGGCAGG No data
Right 989319073 5:40114038-40114060 CAGGAATGAGTTCTCCCCCAGGG No data
989319067_989319073 14 Left 989319067 5:40114001-40114023 CCAAAAAAAAATGGGCATCCGCC No data
Right 989319073 5:40114038-40114060 CAGGAATGAGTTCTCCCCCAGGG No data
989319071_989319073 -7 Left 989319071 5:40114022-40114044 CCAGAAGCTAAAGAGGCAGGAAT No data
Right 989319073 5:40114038-40114060 CAGGAATGAGTTCTCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989319073 Original CRISPR CAGGAATGAGTTCTCCCCCA GGG Intergenic