ID: 989320681

View in Genome Browser
Species Human (GRCh38)
Location 5:40130696-40130718
Sequence TTATCTACAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989320671_989320681 16 Left 989320671 5:40130657-40130679 CCCTTCCCCTAGGTGTTCTGTCC No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320676_989320681 9 Left 989320676 5:40130664-40130686 CCTAGGTGTTCTGTCCGAAGGAG No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320668_989320681 26 Left 989320668 5:40130647-40130669 CCACAGCTGCCCCTTCCCCTAGG No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320672_989320681 15 Left 989320672 5:40130658-40130680 CCTTCCCCTAGGTGTTCTGTCCG No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320673_989320681 11 Left 989320673 5:40130662-40130684 CCCCTAGGTGTTCTGTCCGAAGG No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320670_989320681 17 Left 989320670 5:40130656-40130678 CCCCTTCCCCTAGGTGTTCTGTC No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320679_989320681 -5 Left 989320679 5:40130678-40130700 CCGAAGGAGATGGGAGTTTTATC No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320675_989320681 10 Left 989320675 5:40130663-40130685 CCCTAGGTGTTCTGTCCGAAGGA No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data
989320667_989320681 27 Left 989320667 5:40130646-40130668 CCCACAGCTGCCCCTTCCCCTAG No data
Right 989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989320681 Original CRISPR TTATCTACAAGCCCCTGACT GGG Intergenic