ID: 989323572

View in Genome Browser
Species Human (GRCh38)
Location 5:40165061-40165083
Sequence CTGTGTAGGTTCAAGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989323572_989323583 27 Left 989323572 5:40165061-40165083 CCCAGAGACTTGAACCTACACAG No data
Right 989323583 5:40165111-40165133 GCTGCCCCAAACACATCCACAGG No data
989323572_989323579 2 Left 989323572 5:40165061-40165083 CCCAGAGACTTGAACCTACACAG No data
Right 989323579 5:40165086-40165108 CCCCAAAGGTTTTTCCTGTGGGG No data
989323572_989323577 1 Left 989323572 5:40165061-40165083 CCCAGAGACTTGAACCTACACAG No data
Right 989323577 5:40165085-40165107 GCCCCAAAGGTTTTTCCTGTGGG No data
989323572_989323576 0 Left 989323572 5:40165061-40165083 CCCAGAGACTTGAACCTACACAG No data
Right 989323576 5:40165084-40165106 AGCCCCAAAGGTTTTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989323572 Original CRISPR CTGTGTAGGTTCAAGTCTCT GGG (reversed) Intergenic
No off target data available for this crispr