ID: 989323667

View in Genome Browser
Species Human (GRCh38)
Location 5:40165520-40165542
Sequence GGGACACCTAGCTCCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989323667_989323670 0 Left 989323667 5:40165520-40165542 CCAGTGCAGGAGCTAGGTGTCCC No data
Right 989323670 5:40165543-40165565 TCCCTCTGCAAGACCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989323667 Original CRISPR GGGACACCTAGCTCCTGCAC TGG (reversed) Intergenic