ID: 989323670

View in Genome Browser
Species Human (GRCh38)
Location 5:40165543-40165565
Sequence TCCCTCTGCAAGACCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989323665_989323670 6 Left 989323665 5:40165514-40165536 CCAGTGCCAGTGCAGGAGCTAGG No data
Right 989323670 5:40165543-40165565 TCCCTCTGCAAGACCAGTCCAGG No data
989323667_989323670 0 Left 989323667 5:40165520-40165542 CCAGTGCAGGAGCTAGGTGTCCC No data
Right 989323670 5:40165543-40165565 TCCCTCTGCAAGACCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989323670 Original CRISPR TCCCTCTGCAAGACCAGTCC AGG Intergenic