ID: 989327543

View in Genome Browser
Species Human (GRCh38)
Location 5:40217035-40217057
Sequence ATTTAAGCACTGACGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989327543_989327545 5 Left 989327543 5:40217035-40217057 CCAGGCACCGTCAGTGCTTAAAT No data
Right 989327545 5:40217063-40217085 TTCTCCAAAAAAAGCAAAATAGG No data
989327543_989327548 25 Left 989327543 5:40217035-40217057 CCAGGCACCGTCAGTGCTTAAAT No data
Right 989327548 5:40217083-40217105 AGGAGAATCAGCCAGGTGCATGG No data
989327543_989327547 18 Left 989327543 5:40217035-40217057 CCAGGCACCGTCAGTGCTTAAAT No data
Right 989327547 5:40217076-40217098 GCAAAATAGGAGAATCAGCCAGG No data
989327543_989327549 26 Left 989327543 5:40217035-40217057 CCAGGCACCGTCAGTGCTTAAAT No data
Right 989327549 5:40217084-40217106 GGAGAATCAGCCAGGTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989327543 Original CRISPR ATTTAAGCACTGACGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr