ID: 989329036

View in Genome Browser
Species Human (GRCh38)
Location 5:40234141-40234163
Sequence GTTAAAAATACAAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989329036_989329039 4 Left 989329036 5:40234141-40234163 CCTCCCATCTTTGTATTTTTAAC No data
Right 989329039 5:40234168-40234190 AGCCCACAGCATCCTGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989329036 Original CRISPR GTTAAAAATACAAAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr