ID: 989329942

View in Genome Browser
Species Human (GRCh38)
Location 5:40245413-40245435
Sequence ACTGATTGTCCCCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989329940_989329942 13 Left 989329940 5:40245377-40245399 CCAGAAGTGGAGCAAGATGGCAG No data
Right 989329942 5:40245413-40245435 ACTGATTGTCCCCACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989329942 Original CRISPR ACTGATTGTCCCCACCATGC AGG Intergenic
No off target data available for this crispr