ID: 989339431

View in Genome Browser
Species Human (GRCh38)
Location 5:40356432-40356454
Sequence AAGCTTGGACTGTTGTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989339431_989339435 6 Left 989339431 5:40356432-40356454 CCAATCAACAACAGTCCAAGCTT No data
Right 989339435 5:40356461-40356483 CTCTAGTAAACTGTGAGTCTGGG No data
989339431_989339434 5 Left 989339431 5:40356432-40356454 CCAATCAACAACAGTCCAAGCTT No data
Right 989339434 5:40356460-40356482 CCTCTAGTAAACTGTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989339431 Original CRISPR AAGCTTGGACTGTTGTTGAT TGG (reversed) Intergenic
No off target data available for this crispr