ID: 989342037

View in Genome Browser
Species Human (GRCh38)
Location 5:40387056-40387078
Sequence TGATTTTTACAGATGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989342031_989342037 14 Left 989342031 5:40387019-40387041 CCCCTAGCAGACATTTGGCAATA No data
Right 989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG No data
989342032_989342037 13 Left 989342032 5:40387020-40387042 CCCTAGCAGACATTTGGCAATAT No data
Right 989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG No data
989342030_989342037 15 Left 989342030 5:40387018-40387040 CCCCCTAGCAGACATTTGGCAAT No data
Right 989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG No data
989342033_989342037 12 Left 989342033 5:40387021-40387043 CCTAGCAGACATTTGGCAATATT No data
Right 989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989342037 Original CRISPR TGATTTTTACAGATGGGGTC AGG Intergenic
No off target data available for this crispr