ID: 989360952

View in Genome Browser
Species Human (GRCh38)
Location 5:40600503-40600525
Sequence CCCATTTAGCACTATCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989360952_989360954 5 Left 989360952 5:40600503-40600525 CCTTTCTGATAGTGCTAAATGGG No data
Right 989360954 5:40600531-40600553 AAGCCATCTCATCAGATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989360952 Original CRISPR CCCATTTAGCACTATCAGAA AGG (reversed) Intergenic
No off target data available for this crispr