ID: 989360954

View in Genome Browser
Species Human (GRCh38)
Location 5:40600531-40600553
Sequence AAGCCATCTCATCAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989360950_989360954 15 Left 989360950 5:40600493-40600515 CCAGAGGTGTCCTTTCTGATAGT No data
Right 989360954 5:40600531-40600553 AAGCCATCTCATCAGATCAGTGG No data
989360952_989360954 5 Left 989360952 5:40600503-40600525 CCTTTCTGATAGTGCTAAATGGG No data
Right 989360954 5:40600531-40600553 AAGCCATCTCATCAGATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989360954 Original CRISPR AAGCCATCTCATCAGATCAG TGG Intergenic
No off target data available for this crispr