ID: 989363518

View in Genome Browser
Species Human (GRCh38)
Location 5:40630267-40630289
Sequence AGGTCTCTGCAGGGAGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989363513_989363518 1 Left 989363513 5:40630243-40630265 CCAGGTATTATGGAGGTGATGAA No data
Right 989363518 5:40630267-40630289 AGGTCTCTGCAGGGAGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989363518 Original CRISPR AGGTCTCTGCAGGGAGTACA GGG Intergenic
No off target data available for this crispr