ID: 989365667

View in Genome Browser
Species Human (GRCh38)
Location 5:40652756-40652778
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989365667_989365670 2 Left 989365667 5:40652756-40652778 CCCACACAGACTCTTTTGTACAG No data
Right 989365670 5:40652781-40652803 GAGGCAGCTGCACTCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989365667 Original CRISPR CTGTACAAAAGAGTCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr