ID: 989367508

View in Genome Browser
Species Human (GRCh38)
Location 5:40673383-40673405
Sequence GTGTGTATCTACATGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989367507_989367508 -9 Left 989367507 5:40673369-40673391 CCTCTTCAGGTTAGGTGTGTATC No data
Right 989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG No data
989367506_989367508 -4 Left 989367506 5:40673364-40673386 CCATGCCTCTTCAGGTTAGGTGT No data
Right 989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG No data
989367505_989367508 -3 Left 989367505 5:40673363-40673385 CCCATGCCTCTTCAGGTTAGGTG No data
Right 989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989367508 Original CRISPR GTGTGTATCTACATGTATAT AGG Intergenic
No off target data available for this crispr